Home > Mutants (Isolated) > tm2686

Mutants (Isolated)

Allele Name		tm2686
Allele Type		Normal
Sequence Name		F55A12.1
Gene Name		wago-2
Worm Base	Allele Name	tm2686
	Gene Name	wago-2
	Sequence	F55A12.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		32212/32213-AGAAAAAT-32661/32662 (449 bp deletion + 8 bp insertion)
Chromosome		I
Putative gene structure		join(29611..29775, 29822..29881, 30773..31194, 31240..31972, 32019..32189, 32293..32413, 32464..32810, 32857..33096, 33140..33447, 33493..33604)
Map position		-0.03
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CCCTAGTAAGGAAGTGACGT,IntFwd:CGTTCTTGACCGTCGCGATA,ExtRev:CCGATGCTCCACTCCTGTAG,IntRev:CTGTGTTGAAGGAGCCAAGA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Marnik EA, Almeida MV, Cipriani PG, Chung G, Caspani E, Karaulanov E, Gan HH, Zinno J, Isolehto IJ, Kielisch F, Butter F, Sharp CS, Flanagan RM, Bonnet FX, Piano F, Ketting RF, Gunsalus KC, Updike DL. The Caenorhabditis elegans TDRD5/7-like protein, LOTR-1, interacts with the helicase ZNFX-1 to balance epigenetic signals in the germline. PLoS Genet 2022 18(6) e1010245  [ PubMed ID = 35657999 ] [ RRC reference ] Placentino M, de Jesus Domingues AM, Schreier J, Dietz S, Hellmann S, de Albuquerque BF, Butter F, Ketting RF. Intrinsically disordered protein PID-2 modulates Z granules and is required for heritable piRNA-induced silencing in the Caenorhabditis elegans embryo. EMBO J 2021 40(3) e105280  [ PubMed ID = 33231880 ] [ RRC reference ] Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A. Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans. mBio 2017 8(5)   [ PubMed ID = 29018118 ] [ RRC reference ] Hall SE, Chirn GW, Lau NC, Sengupta P. RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans. RNA 2013 19(3) 306-19  [ PubMed ID = 23329696 ] [ RRC reference ] Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S. Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans. Genetics 2014 197(1) 121-32  [ PubMed ID = 24532782 ] [ RRC reference ] Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC. Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline. Mol Cell 2009 36(2) 231-44  [ PubMed ID = 19800275 ] [ RRC reference ]