Mutants (Isolated)

tm2685

Allele Nametm2685
Sequence NameY57A10A.15
CGC Namepolg-1
Worm BaseAllele Name tm2685
CGC Name polg-1
Sequence Y57A10A.15
Phenotypelethal or sterile
Mutation site62921/62922-63407/63408 (486 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(53507..53659, 53863..54090, 54916..55216, 56472..56874, 57618..57988, 59080..59628, 61225..61582, 61709..61793, 62568..63020, 63272..63589))
Map position6.94
Balancerrol-1 (e91)
Map position of balancer
Sequence of primersIntFwd:CCCGACATCTGGCTCGATCA,ExtFwd:GATAAGCCTCCCGACATCTG,ExtRev:GCGTCCTCCGAAAATAATGC,IntRev:CCACGTATCCCGCCGACAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sugimoto T, Mori C, Takanami T, Sasagawa Y, Saito R, Ichiishi E, Higashitani A.
Caenorhabditis elegans par2.1/mtssb-1 is essential for mitochondrial DNA replication and its defect causes comprehensive transcriptional alterations including a hypoxia response.
Exp. Cell Res. 2008 314(1) 103-14 
[ PubMed ID = 17900564 ] [ RRC reference ]

Hench J, Bratić Hench I, Pujol C, Ipsen S, Brodesser S, Mourier A, Tolnay M, Frank S, Trifunović A.
A tissue-specific approach to the analysis of metabolic changes in Caenorhabditis elegans.
PLoS ONE 2011 6(12) e28417 
[ PubMed ID = 22162770 ] [ RRC reference ]

Bratic I, Hench J, Trifunovic A.
Caenorhabditis elegans as a model system for mtDNA replication defects.
Methods 2010 51(4) 437-43 
[ PubMed ID = 20230897 ] [ RRC reference ]