Allele Name | tm2679 |
Allele Type | 通常株 |
Sequence Name | C10F3.4 |
Gene Name | mcp-1 |
Worm Base | Allele Name |
tm2679
|
Gene Name |
mcp-1
|
Sequence |
C10F3.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 7502/7503-7946/7947 (444 bp deletion) |
Chromosome | V |
Putative gene structure | join(4436..4504, 5966..6112, 6786..6899, 7068..7175, 7228..7527, 7575..7690, 7776..7856, 7900..8054, 8178..8266, 8320..8397, 8455..8574) |
Map position | -0.64 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:TGCGACACGGATCCTATCAG,ExtRev:CGGGTTCTGACACAAGCCAA,IntFwd:GACCGTCATTTAGTAGCTGT,IntRev:CAGCGCTTCTCAGAACGAGA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Schulz A, Sekine Y, Oyeyemi MJ, Abrams AJ, Basavaraju M, Han SM, Groth M, Morrison H, Strittmatter SM, Hammarlund M. The stress-responsive gene GDPGP1/mcp-1 regulates neuronal glycogen metabolism and survival. J Cell Biol 2020 219(2)
[ PubMed ID = 31968056 ]
[ RRC reference ]
|
Patananan AN, Budenholzer LM, Pedraza ME, Torres ER, Adler LN, Clarke SG. The invertebrate Caenorhabditis elegans biosynthesizes ascorbate. Arch Biochem Biophys 2015 569 32-44
[ PubMed ID = 25668719 ]
[ RRC reference ]
|
Adler LN, Gomez TA, Clarke SG, Linster CL. A novel GDP-D-glucose phosphorylase involved in quality control of the nucleoside diphosphate sugar pool in Caenorhabditis elegans and mammals. J Biol Chem 2011 286(24) 21511-23
[ PubMed ID = 21507950 ]
[ RRC reference ]
|
Khare S, Gomez T, Linster CL, Clarke SG. Defective responses to oxidative stress in protein l-isoaspartyl repair-deficient Caenorhabditis elegans. Mech Ageing Dev 2009 130(10) 670-80
[ PubMed ID = 19682488 ]
[ RRC reference ]
|
|