Allele Name | tm2657 |
Sequence Name | D1007.7 |
CGC Name | nrd-1 |
Worm Base | Allele Name |
tm2657
|
CGC Name |
nrd-1
|
Sequence |
D1007.7
|
Phenotype | homozygous viable. Dr. M. Han: fertile, wild-type growth and normal vulval development. Dr. T. Blumenthal: brood size normal and no embryo lethality. |
Mutation site | 43452/43453-43832/43833 (380 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join(40740..40921, 40977..41071, 41562..42013, 42333..42467, 42529..43067, 43334..43956, 44026..44545, 44592..44850, 44920..45081)) |
Map position | -1.04 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:GGGATCACCATGGAGACGGA,IntRev:TCAGTGCAAGCCAGATCAAC,ExtFwd:CTAACAGGTGGCAATCCCAT,IntFwd:CCTTAATCGAGCTCGTTCCA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Nordquist SK, Smith SR, Pierce JT. Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans. G3 (Bethesda) 2018 8(3) 967-979
[ PubMed ID = 29367452 ]
[ RRC reference ]
|
Chen F, Zhou Y, Qi YB, Khivansara V, Li H, Chun SY, Kim JK, Fu XD, Jin Y. Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development. Genes Dev 2015 29(22) 2377-90
[ PubMed ID = 26588990 ]
[ RRC reference ]
|
|