Mutants (Isolated)

tm2657

Allele Nametm2657
Sequence NameD1007.7
CGC Namenrd-1
Worm BaseAllele Name tm2657
CGC Name nrd-1
Sequence D1007.7
Phenotypehomozygous viable. Dr. M. Han: fertile, wild-type growth and normal vulval development. Dr. T. Blumenthal: brood size normal and no embryo lethality.
Mutation site43452/43453-43832/43833 (380 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(40740..40921, 40977..41071, 41562..42013, 42333..42467, 42529..43067, 43334..43956, 44026..44545, 44592..44850, 44920..45081))
Map position-1.04
Balancer
Map position of balancer
Sequence of primersExtRev:GGGATCACCATGGAGACGGA,IntRev:TCAGTGCAAGCCAGATCAAC,ExtFwd:CTAACAGGTGGCAATCCCAT,IntFwd:CCTTAATCGAGCTCGTTCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]

Chen F, Zhou Y, Qi YB, Khivansara V, Li H, Chun SY, Kim JK, Fu XD, Jin Y.
Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development.
Genes Dev. 2015 29(22) 2377-90 
[ PubMed ID = 26588990 ] [ RRC reference ]