Mutants (Isolated)

tm2654

Allele Nametm2654
BalanceNot Required
OutCrossNot Accepted
Sequence NameF16D3.7
Gene Nameser-5
Worm BaseAllele Name tm2654
Gene Name ser-5
Sequence F16D3.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Ashrafi: increased Nile Red staining.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [T19A6] 768/769-[T19A6] 1116/1117 (348 bp deletion)
ChromosomeI
Putative gene structurejoin(32458..32583, AL021571.1:140..457, AL021571.1:503..676, AL021571.1:729..1661)
Map position2.77
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTGGGATAAGTACGGGCAA,IntFwd:GCTTCGAATAATTCTCCGTG,ExtRev:GCCTCCTTTTGGATCGAACT,IntRev:CAAACGATCGGTGCCTTGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lemieux GA, Yoo S, Lin L, Vohra M, Ashrafi K.
The steroid hormone ADIOL promotes learning by reducing neural kynurenic acid levels.
Genes Dev 2023 37(21-24) 998-1016 
[ PubMed ID = 38092521 ] [ RRC reference ]

Aprison EZ, Ruvinsky I.
Coordinated Behavioral and Physiological Responses to a Social Signal Are Regulated by a Shared Neuronal Circuit.
Curr Biol 2019 29(23) 4108-4115.e4 
[ PubMed ID = 31708394 ] [ RRC reference ]

Oakes M, Law WJ, Komuniecki R.
Cannabinoids Stimulate the TRP Channel-Dependent Release of Both Serotonin and Dopamine to Modulate Behavior in C. elegans.
J Neurosci 2019 39(21) 4142-4152 
[ PubMed ID = 30886012 ] [ RRC reference ]

Williams PDE, Zahratka JA, Rodenbeck M, Wanamaker J, Linzie H, Bamber BA.
Serotonin Disinhibits a Caenorhabditis elegans Sensory Neuron by Suppressing Ca2+-Dependent Negative Feedback.
J Neurosci 2018 38(8) 2069-2080 
[ PubMed ID = 29358363 ] [ RRC reference ]

Churgin MA, McCloskey RJ, Peters E, Fang-Yen C.
Antagonistic Serotonergic and Octopaminergic Neural Circuits Mediate Food-Dependent Locomotory Behavior in Caenorhabditis elegans.
J Neurosci 2017 37(33) 7811-7823 
[ PubMed ID = 28698386 ] [ RRC reference ]

Rangaraju S, Solis GM, Thompson RC, Gomez-Amaro RL, Kurian L, Encalada SE, Niculescu AB 3rd, Salomon DR, Petrascheck M.
Suppression of transcriptional drift extends C. elegans lifespan by postponing the onset of mortality.
Elife 2015 4 e08833 
[ PubMed ID = 26623667 ] [ RRC reference ]

Law W, Wuescher LM, Ortega A, Hapiak VM, Komuniecki PR, Komuniecki R.
Heterologous Expression in Remodeled C. elegans: A Platform for Monoaminergic Agonist Identification and Anthelmintic Screening.
PLoS Pathog 2015 11(4) e1004794 
[ PubMed ID = 25928899 ] [ RRC reference ]

Zahratka JA, Williams PD, Summers PJ, Komuniecki RW, Bamber BA.
Serotonin differentially modulates Ca2+ transients and depolarization in a C. elegans nociceptor.
J Neurophysiol 2015 113(4) 1041-50 
[ PubMed ID = 25411461 ] [ RRC reference ]

Cunningham KA, Bouagnon AD, Barros AG, Lin L, Malard L, Romano-Silva MA, Ashrafi K.
Loss of a neural AMP-activated kinase mimics the effects of elevated serotonin on fat, movement, and hormonal secretions.
PLoS Genet 2014 10(6) e1004394 
[ PubMed ID = 24921650 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Brown AE, Yemini EI, Grundy LJ, Jucikas T, Schafer WR.
A dictionary of behavioral motifs reveals clusters of genes affecting Caenorhabditis elegans locomotion.
Proc Natl Acad Sci U S A 2013 110(2) 791-6 
[ PubMed ID = 23267063 ] [ RRC reference ]

Cunningham KA, Hua Z, Srinivasan S, Liu J, Lee BH, Edwards RH, Ashrafi K.
AMP-activated kinase links serotonergic signaling to glutamate release for regulation of feeding behavior in C. elegans.
Cell Metab 2012 16(1) 113-21 
[ PubMed ID = 22768843 ] [ RRC reference ]

Vidal-Gadea A, Topper S, Young L, Crisp A, Kressin L, Elbel E, Maples T, Brauner M, Erbguth K, Axelrod A, Gottschalk A, Siegel D, Pierce-Shimomura JT.
Caenorhabditis elegans selects distinct crawling and swimming gaits via dopamine and serotonin.
Proc Natl Acad Sci U S A 2011 108(42) 17504-9 
[ PubMed ID = 21969584 ] [ RRC reference ]

Harris G, Korchnak A, Summers P, Hapiak V, Law WJ, Stein AM, Komuniecki P, Komuniecki R.
Dissecting the serotonergic food signal stimulating sensory-mediated aversive behavior in C. elegans.
PLoS One 2011 6(7) e21897 
[ PubMed ID = 21814562 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J Neurosci 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]

Govorunova EG, Moussaif M, Kullyev A, Nguyen KC, McDonald TV, Hall DH, Sze JY.
A homolog of FHM2 is involved in modulation of excitatory neurotransmission by serotonin in C. elegans.
PLoS One 2010 5(4) e10368 
[ PubMed ID = 20442779 ] [ RRC reference ]

Harris GP, Hapiak VM, Wragg RT, Miller SB, Hughes LJ, Hobson RJ, Steven R, Bamber B, Komuniecki RW.
Three distinct amine receptors operating at different levels within the locomotory circuit are each essential for the serotonergic modulation of chemosensation in Caenorhabditis elegans.
J Neurosci 2009 29(5) 1446-56 
[ PubMed ID = 19193891 ] [ RRC reference ]

Hapiak VM, Hobson RJ, Hughes L, Smith K, Harris G, Condon C, Komuniecki P, Komuniecki RW.
Dual excitatory and inhibitory serotonergic inputs modulate egg laying in Caenorhabditis elegans.
Genetics 2009 181(1) 153-63 
[ PubMed ID = 19001289 ] [ RRC reference ]