Mutants (Isolated)

tm2649

Allele Nametm2649
Sequence NameR06C7.7
CGC Namelin-61
Worm BaseAllele Name tm2649
CGC Name lin-61
Sequence R06C7.7
Phenotypehomozygous viable
Mutation site17467/17468-18139/18140 (672 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(16631..16709, 16764..16903, 16991..17800, 17851..17947, 18074..18240, 18289..18471))
Map position1.86
Balancer
Map position of balancer
Sequence of primersExtFwd:CAAGTCAAGCGGTAGGGTTT,IntFwd:GCGGTAGGGTTTCTGCAGAT,ExtRev:CGAATGCGTGAAGGAAGGAG,IntRev:ACTGCGATTCGATTCAAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Koester-Eiserfunke N, Fischle W.
H3K9me2/3 binding of the MBT domain protein LIN-61 is essential for Caenorhabditis elegans vulva development.
PLoS Genet. 2011 7(3) e1002017 
[ PubMed ID = 21437264 ] [ RRC reference ]

Johnson NM, Lemmens BB, Tijsterman M.
A role for the malignant brain tumour (MBT) domain protein LIN-61 in DNA double-strand break repair by homologous recombination.
PLoS Genet. 2013 9(3) e1003339 
[ PubMed ID = 23505385 ] [ RRC reference ]

Wu X, Shi Z, Cui M, Han M, Ruvkun G.
Repression of germline RNAi pathways in somatic cells by retinoblastoma pathway chromatin complexes.
PLoS Genet. 2012 8(3) e1002542 
[ PubMed ID = 22412383 ] [ RRC reference ]