Mutants (Isolated)

tm2645

Allele Nametm2645
Sequence NameT24H10.6
CGC Namedyrb-1
Worm BaseAllele Name tm2645
CGC Name dyrb-1
Sequence T24H10.6
Phenotypelethal or sterile. Dr. B.A. Bowerman: Dpy, Egl, Pvl, 85% Emb, Dr. M. Gotta: J Cell Biol 179, 15 (2007).
Mutation site8769/8770-9523/9524 (754 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(9324..9532, 9767..9845))
Map position1.04
BalancermIn1 [mIs14]
Map position of balancer
Sequence of primersIntFwd:CCAACGCAACGGAAGCTAAG,ExtFwd:GGCGTACGGTAGTACTATAC,IntRev:ACGAGCACTTCAGATGTAAG,ExtRev:CTATCGGATTCGATGGCGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Couwenbergs C, Labbé JC, Goulding M, Marty T, Bowerman B, Gotta M.
Heterotrimeric G protein signaling functions with dynein to promote spindle positioning in C. elegans.
J. Cell Biol. 2007 179(1) 15-22 
[ PubMed ID = 17908918 ] [ RRC reference ]

O'Rourke SM, Dorfman MD, Carter JC, Bowerman B.
Dynein modifiers in C. elegans: light chains suppress conditional heavy chain mutants.
PLoS Genet. 2007 3(8) e128 
[ PubMed ID = 17676955 ] [ RRC reference ]

Feldman JL, Priess JR.
A role for the centrosome and PAR-3 in the hand-off of MTOC function during epithelial polarization.
Curr. Biol. 2012 22(7) 575-82 
[ PubMed ID = 22425160 ] [ RRC reference ]