Mutants (Isolated)

tm2644

Allele Nametm2644
Sequence NameF56A3.2
CGC Namegiyd-1
Worm BaseAllele Name tm2644
CGC Name giyd-1
Sequence F56A3.2
Phenotypehomozygous viable
Mutation site14117/14118-14322/14323 (205 bp deletion)
ChromosomeI
Putative gene structurejoin(11707..11819, 11865..12243, 13559..13737, 13798..13941, 14271..14346, 14404..14559, 14614..14805, 15019..15111)
Map position-0.31
Balancer
Map position of balancer
Sequence of primersExtFwd:AGCGTTTACTCCTCGCGGAA,IntFwd:CCGCAAGGATTATACAAGCT,ExtRev:GGGTAGTACACAATCTGCGT,IntRev:ACATGTTGGGCAATTGGCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Saito TT, Colaiácovo MP.
Regulation of Crossover Frequency and Distribution during Meiotic Recombination.
Cold Spring Harb. Symp. Quant. Biol. 2017 82 223-234 
[ PubMed ID = 29222342 ] [ RRC reference ]

Saito TT, Mohideen F, Meyer K, Harper JW, Colaiácovo MP.
SLX-1 is required for maintaining genomic integrity and promoting meiotic noncrossovers in the Caenorhabditis elegans germline.
PLoS Genet. 2012 8(8) e1002888 
[ PubMed ID = 22927825 ] [ RRC reference ]

Ujisawa T, Ohta A, Ii T, Minakuchi Y, Toyoda A, Ii M, Kuhara A.
Endoribonuclease ENDU-2 regulates multiple traits including cold tolerance via cell autonomous and nonautonomous controls in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2018 115(35) 8823-8828 
[ PubMed ID = 30104389 ] [ RRC reference ]

Agostinho A, Meier B, Sonneville R, Jagut M, Woglar A, Blow J, Jantsch V, Gartner A.
Combinatorial regulation of meiotic holliday junction resolution in C. elegans by HIM-6 (BLM) helicase, SLX-4, and the SLX-1, MUS-81 and XPF-1 nucleases.
PLoS Genet. 2013 9(7) e1003591 
[ PubMed ID = 23901331 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9 
[ PubMed ID = 24768858 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res. 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]