Mutants (Isolated)

tm2625

Allele Nametm2625
Sequence NameY57A10A.19
CGC Namersr-2
Worm BaseAllele Name tm2625
CGC Name rsr-2
Sequence Y57A10A.19
Phenotypelethal or sterile
Mutation site89380/89381-GT-89717/89718 (337 bp deletion + 2 bp insertion)
ChromosomeII
Putative gene structurejoin(88988..89077, 89226..90206, 90647..90853)
Map position7.09
BalancermnC1 [nIs190] II
Map position of balancer
Sequence of primersIntFwd:CTCCTAGAGGACAAGGGCCT,ExtFwd:CGAGGTGAAATGCACCGAAT,ExtRev:ATCCCGGCGTTGTGGTGACT,IntRev:TTGTGGTGACTTCCGACGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fontrodona L, Porta-de-la-Riva M, Morán T, Niu W, Díaz M, Aristizábal-Corrales D, Villanueva A, Schwartz S Jr, Reinke V, Cerón J.
RSR-2, the Caenorhabditis elegans ortholog of human spliceosomal component SRm300/SRRM2, regulates development by influencing the transcriptional machinery.
PLoS Genet. 2013 9(6) e1003543 
[ PubMed ID = 23754964 ] [ RRC reference ]