Mutants (Isolated)

tm2622

Allele Nametm2622
Sequence NameC38D4.8
CGC Namearl-6
Worm BaseAllele Name tm2622
CGC Name arl-6
Sequence C38D4.8
Phenotypehomozygous viable.
Mutation site32246/32247-AAAATTTGAAATTCAAGC-32468/32469 (222 bp deletion + 18 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(30972..31102, 31153..31228, 31696..31841, 32258..32477))
Map position-2.45
Balancer
Map position of balancer
Sequence of primersExtFwd:GAGCCCTACGCCGAAAAAGT,IntRev:ATATCCTAGTATGTCCCCCA,ExtRev:ACACTTTAAGCTTCCAAGAC,IntFwd:TACTGACCGAAAGATTCTAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198 
[ PubMed ID = 27306325 ] [ RRC reference ]