Mutants (Isolated)

tm2610

Allele Nametm2610
Sequence NameF29B9.6
CGC Nameubc-9
Worm BaseAllele Name tm2610
CGC Name ubc-9
Sequence F29B9.6
Phenotypelethal or sterile
Mutation site5621/5622-5936/5937 (315 bp deletion)
ChromosomeIV
Putative gene structurejoin(5192..5245, 5371..5493, 5628..5718, 5764..5917, 5974..6052)
Map position0.52
BalancernT1
Map position of balancer
Sequence of primersIntFwd:TGTCGGGAATTGCTGCAGGA,ExtRev:ACAATCGTTGCCGCATACAG,IntRev:CCACGAAGCAAGCATCTACT,ExtFwd:ACAAGTGTCACGAACACGCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Reichman R, Shi Z, Malone R, Smolikove S.
Mitotic and Meiotic Functions for the SUMOylation Pathway in the Caenorhabditis elegans Germline.
Genetics 2018 208(4) 1421-1441 
[ PubMed ID = 29472245 ] [ RRC reference ]

Pelisch F, Sonneville R, Pourkarimi E, Agostinho A, Blow JJ, Gartner A, Hay RT.
Erratum: Dynamic SUMO modification regulates mitotic chromosome assembly and cell cycle progression in Caenorhabditis elegans.
Nat Commun 2015 6 6352 
[ PubMed ID = 25672768 ] [ RRC reference ]

Sakai Y, Hanafusa H, Pastuhov SI, Shimizu T, Li C, Hisamoto N, Matsumoto K.
TDP2 negatively regulates axon regeneration by inducing SUMOylation of an Ets transcription factor.
EMBO Rep 2019 20(10) e47517 
[ PubMed ID = 31393064 ] [ RRC reference ]

Lim Y, Lee D, Kalichamy K, Hong SE, Michalak M, Ahnn J, Kim DH, Lee SK.
Sumoylation regulates ER stress response by modulating calreticulin gene expression in XBP-1-dependent mode in Caenorhabditis elegans.
Int J Biochem Cell Biol 2014 53 399-408 
[ PubMed ID = 24933177 ] [ RRC reference ]

Bhalla N, Wynne DJ, Jantsch V, Dernburg AF.
ZHP-3 acts at crossovers to couple meiotic recombination with synaptonemal complex disassembly and bivalent formation in C. elegans.
PLoS Genet 2008 4(10) e1000235 
[ PubMed ID = 18949042 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]