Mutants (Isolated)

tm2605

Allele Nametm2605
Sequence NameF11A10.4
CGC Namemon-2
Worm BaseAllele Name tm2605
CGC Name mon-2
Sequence F11A10.4
Phenotypehomozygous viable
Mutation site17276/17277-17745/17746 (469 bp deletion)
ChromosomeIV
Putative gene structurejoin(16254..16559, 16930..17061, 17112..17468, 17526..17759, 17813..18053, 18637..18745, 18793..19620, Z68507.1:105..285, Z68507.1:647..930, Z68507.1:978..1146, Z68507.1:1643..2794, Z68507.1:3288..3601, Z68507.1:4552..4736, Z68507.1:4880..5031, Z68507.1:5081..5377)
Map position5.69
Balancer
Map position of balancer
Sequence of primersIntRev:GCGTCGAATTAGGACGACAA,IntFwd:TGGTCCCTAGTGGAAGCAGA,ExtRev:AACATGCGTCGAATTAGGAC,ExtFwd:AACGGCGCCACAATTGTAAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Díaz-Balzac CA, Rahman M, Lázaro-Peña MI, Martin Hernandez LA, Salzberg Y, Aguirre-Chen C, Kaprielian Z, Bülow HE.
Muscle- and Skin-Derived Cues Jointly Orchestrate Patterning of Somatosensory Dendrites.
Curr Biol 2016 26(17) 2379-87 
[ PubMed ID = 27451901 ] [ RRC reference ]