Mutants (Isolated)

tm2597

Allele Nametm2597
Sequence NameE04F6.2
CGC Namepcrg-1
Worm BaseAllele Name tm2597
CGC Name pcrg-1
Sequence E04F6.2
Phenotypehomozygous viable. Dr. K. Oegema: wild-type dyf.
Mutation site13667/13668-14347/14348 (680 bp deletion)
ChromosomeII
Putative gene structurejoin(12503..12570, 12718..12795, 13792..13927, 14032..14127, 14197..14285, 14328..14430, 14474..14705, 14751..14923)
Map position-0.5
Balancer
Map position of balancer
Sequence of primersExtFwd:TGCAGAGGGTTTCTCGACGT,IntFwd:TCAAGTCAACCGCCCGTATG,ExtRev:AGCCCTGCTCGAATTCCTCT,IntRev:GTGACATTCCCGTGGAGAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Loucks CM, Bialas NJ, Dekkers MP, Walker DS, Grundy LJ, Li C, Inglis PN, Kida K, Schafer WR, Blacque OE, Jansen G, Leroux MR.
PACRG, a protein linked to ciliary motility, mediates cellular signaling.
Mol Biol Cell 2016 27(13) 2133-44 
[ PubMed ID = 27193298 ] [ RRC reference ]