Mutants (Isolated)

tm2596

Allele Nametm2596
Sequence NameF09G8.9
CGC Namemps-4
Worm BaseAllele Name tm2596
CGC Name mps-4
Sequence F09G8.9
Phenotypehomozygous viable
Mutation site18622/18623-19055/19056 (433 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(18892..18947, 19230..19348, 19397..19497))
Map position-0.35
Balancer
Map position of balancer
Sequence of primersExtFwd:GTACGAGTACTAGTCAGGTA,ExtRev:GTATCATCGCCGAGTTATTC,IntFwd:ACGTCACAGAAATGCGTGTA,IntRev:ACCCGGAAGAAAGGGTGATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Swiatkowski P, Sesti F.
Delayed pharyngeal repolarization promotes abnormal calcium buildup in aging muscle.
Biochem. Biophys. Res. Commun. 2013 433(3) 354-7 
[ PubMed ID = 23510998 ] [ RRC reference ]