Home > Mutants (Isolated) > tm2596

Mutants (Isolated)

Allele Name		tm2596
Allele Type		Normal
Sequence Name		F09G8.9
Gene Name		mps-4
Worm Base	Allele Name	tm2596
	Gene Name	mps-4
	Sequence	F09G8.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		18622/18623-19055/19056 (433 bp deletion)
Chromosome		III
Putative gene structure		complement(join(18892..18947, 19230..19348, 19397..19497))
Map position		-0.35
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GTACGAGTACTAGTCAGGTA,ExtRev:GTATCATCGCCGAGTTATTC,IntFwd:ACGTCACAGAAATGCGTGTA,IntRev:ACCCGGAAGAAAGGGTGATC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Swiatkowski P, Sesti F. Delayed pharyngeal repolarization promotes abnormal calcium buildup in aging muscle. Biochem Biophys Res Commun 2013 433(3) 354-7  [ PubMed ID = 23510998 ] [ RRC reference ]