Mutants (Isolated)

tm2595

Allele Nametm2595
Sequence NameZK20.3
CGC Namerad-23
Worm BaseAllele Name tm2595
CGC Name rad-23
Sequence ZK20.3
Phenotypehomozygous viable. Dr. W. Vermeulen: survival is not affected by UV irradiation. Dr. A. Colavita: J. Neurosci. 305, 1766 (2010).
Mutation site30380/30381-ATTCAAAAGATCCATGAAAGCAAGCTTG-31057/31058 (677 bp deletion + 28 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(30077..30088, 30143..30946, 30996..31079, 31126..31198, 31319..31464))
Map position3.82
Balancer
Map position of balancer
Sequence of primersExtFwd:GTCACATGCGAAATAAGCCT,IntFwd:CATGCGAAATAAGCCTCCAC,ExtRev:CCTTTAAGACGCCAAGCCAT,IntRev:CAGGATGGTTTTGTCCGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhou Q, Li H, Li H, Nakagawa A, Lin JL, Lee ES, Harry BL, Skeen-Gaar RR, Suehiro Y, William D, Mitani S, Yuan HS, Kang BH, Xue D.
Mitochondrial endonuclease G mediates breakdown of paternal mitochondria upon fertilization.
Science 2016 353(6297) 394-9 
[ PubMed ID = 27338704 ] [ RRC reference ]

Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W.
Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development.
PLoS Genet. 2010 6(5) e1000941 
[ PubMed ID = 20463888 ] [ RRC reference ]

Kuhlbrodt K, Janiesch PC, Kevei É, Segref A, Barikbin R, Hoppe T.
The Machado-Joseph disease deubiquitylase ATX-3 couples longevity and proteostasis.
Nat. Cell Biol. 2011 13(3) 273-81 
[ PubMed ID = 21317884 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J. Neurosci. 2015 35(42) 14286-306 
[ PubMed ID = 26490867 ] [ RRC reference ]

Habibi-Babadi N, Su A, de Carvalho CE, Colavita A.
The N-glycanase png-1 acts to limit axon branching during organ formation in Caenorhabditis elegans.
J. Neurosci. 2010 30(5) 1766-76 
[ PubMed ID = 20130186 ] [ RRC reference ]