| Allele Name | tm2593 |
| Sequence Name | F07A5.1a |
| CGC Name | inx-14 |
| Worm Base | Allele Name |
tm2593
|
| CGC Name |
inx-14
|
| Sequence |
F07A5.1a
|
| Phenotype | lethal or sterile. Dr. K. Subramaniam: normal locomotion. Dr. D. Greenstein: Ste. |
| Mutation site | 2319/2320-TTTGT-2689/2690 (370 bp deletion + 5 bp insertion) |
| Chromosome | I |
| Putative gene structure | complement(join(1620..1657, 1701..1746, 1797..2078, 2125..2376, 2449..2732, 2780..2989, 3033..3219)) |
| Map position | 1.97 |
| Balancer | hT2 [qIs48] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:ACTGTCGAATGGCTCTCGTT,ExtRev:GCGGCGAAGCTCTACGAATT,IntFwd:CAATTACCGAGAGCGCGGTG,IntRev:TCTACTCACTGGTGCTAAAC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Miyata S, Begun J, Troemel ER, Ausubel FM.
DAF-16-dependent suppression of immunity during reproduction in Caenorhabditis elegans.
Genetics 2008 178(2) 903-18
[ PubMed ID = 18245330 ]
[ RRC reference ]
|
Miyata S, Begun J, Troemel ER, Ausubel FM.
DAF-16-dependent suppression of immunity during reproduction in Caenorhabditis elegans.
Genetics 2008 178(2) 903-18
[ PubMed ID = 18245330 ]
[ RRC reference ]
|
Govindan JA, Nadarajan S, Kim S, Starich TA, Greenstein D.
Somatic cAMP signaling regulates MSP-dependent oocyte growth and meiotic maturation in C. elegans.
Development 2009 136(13) 2211-21
[ PubMed ID = 19502483 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.