Mutants (Isolated)

tm2581

Allele Nametm2581
Sequence NameM03A8.1
CGC Namedhs-28
Worm BaseAllele Name tm2581
CGC Name dhs-28
Sequence M03A8.1
Phenotypehomozygous viable
Mutation site17551/17552-18259/18260 (708 bp deletion)
ChromosomeX
Putative gene structurejoin(17476..17749, 17799..17867, 17915..18186, 18229..18694, 18741..18874, 18925..19020)
Map position-2.4
Balancer
Map position of balancer
Sequence of primersIntFwd:CGCGCGTTTTCTTGCCCACA,ExtRev:CAGTGGTATGCACTCCGGAA,ExtFwd:CGACTCGAGTGTACCGTTAT,IntRev:TCCGCTCATGAATGCCTGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li S, Xu S, Ma Y, Wu S, Feng Y, Cui Q, Chen L, Zhou S, Kong Y, Zhang X, Yu J, Wu M, Zhang SO.
A Genetic Screen for Mutants with Supersized Lipid Droplets in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(8) 2407-19 
[ PubMed ID = 27261001 ] [ RRC reference ]

Park JY, Joo HJ, Park S, Paik YK.
Ascaroside Pheromones: Chemical Biology and Pleiotropic Neuronal Functions.
Int J Mol Sci 2019 20(16)  
[ PubMed ID = 31405082 ] [ RRC reference ]

Wang R, Kniazeva M, Han M.
Peroxisome protein transportation affects metabolism of branched-chain fatty acids that critically impact growth and development of C. elegans.
PLoS One 2013 8(9) e76270 
[ PubMed ID = 24086720 ] [ RRC reference ]

Park S, Paik YK.
Genetic deficiency in neuronal peroxisomal fatty acid β-oxidation causes the interruption of dauer development in Caenorhabditis elegans.
Sci Rep 2017 7(1) 9358 
[ PubMed ID = 28839231 ] [ RRC reference ]

Jeong H, Paik YK.
MGL-1 on AIY neurons translates starvation to reproductive plasticity via neuropeptide signaling in Caenorhabditis elegans.
Dev Biol 2017 430(1) 80-89 
[ PubMed ID = 28807780 ] [ RRC reference ]

Joo HJ, Yim YH, Jeong PY, Jin YX, Lee JE, Kim H, Jeong SK, Chitwood DJ, Paik YK.
Caenorhabditis elegans utilizes dauer pheromone biosynthesis to dispose of toxic peroxisomal fatty acids for cellular homoeostasis.
Biochem J 2009 422(1) 61-71 
[ PubMed ID = 19496754 ] [ RRC reference ]