Mutants (Isolated)

tm2572

Allele Nametm2572
Sequence NameW03A3.2
CGC Namepolq-1
Worm BaseAllele Name tm2572
CGC Name polq-1
Sequence W03A3.2
Phenotypehomozygous viable
Mutation site13964/13965-ATCTTTCGGGTCGTTTGCCAACTGCTCAACCTCTGCACAGTCACAAGTGACACGCACAGGGCCGTGGTGCGCAGAGGCACGGCGATGATCCAGCTGCAGGTTCACCTACAGCTACCTTGTTACGACTTTTACCCGGTTCAAACCAATGCGATAA-14612/14613 (648 bp deletion + 154 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(3668..3849, 4228..4437, 4489..4822, 4944..5612, 5668..5825, 6090..6318, 6365..6468, 6695..7452, 8474..8578, 9009..9147, 9281..9350, 9541..9774, 9829..9906, 10014..10292))
Map position-1.45
Balancer
Map position of balancer
Sequence of primersExtFwd:GGTGCACCATGATAGGTATT,IntFwd:TTACGACAGTGACACCACAA,ExtRev:TGTACCATCGAAAAAGCAGC,IntRev:CGATTCGTCTCGTGGTGCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Asagoshi K, Lehmann W, Braithwaite EK, Santana-Santos L, Prasad R, Freedman JH, Van Houten B, Wilson SH.
Single-nucleotide base excision repair DNA polymerase activity in C. elegans in the absence of DNA polymerase β.
Nucleic Acids Res. 2012 40(2) 670-81 
[ PubMed ID = 21917855 ] [ RRC reference ]

Papaluca A, Wagner JR, Saragovi HU, Ramotar D.
UNG-1 and APN-1 are the major enzymes to efficiently repair 5-hydroxymethyluracil DNA lesions in C. elegans.
Sci Rep 2018 8(1) 6860 
[ PubMed ID = 29717169 ] [ RRC reference ]

Koole W, van Schendel R, Karambelas AE, van Heteren JT, Okihara KL, Tijsterman M.
A Polymerase Theta-dependent repair pathway suppresses extensive genomic instability at endogenous G4 DNA sites.
Nat Commun 2014 5 3216 
[ PubMed ID = 24496117 ] [ RRC reference ]