Mutants (Isolated)

tm2571

Allele Nametm2571
Sequence NameY37E3.9
CGC Namephb-1
Worm BaseAllele Name tm2571
CGC Name phb-1
Sequence Y37E3.9
Phenotypelethal or sterile
Mutation site12455/12456-AAAA-12917/12918 (462 bp deletion + 4 bp insertion)
ChromosomeI
Putative gene structurejoin(12254..12655, 12725..12841, 12891..13199)
Map position-11.89
BalancerhT2
Map position of balancer
Sequence of primersIntFwd:ACAGAAGCTTTTGGGTCGCT,ExtFwd:CGATGAAATGCAGCCTCCCT,IntRev:CTTGTTCTTGGCCATACGCT,ExtRev:GTCTAAAACACGTAACCGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hernando-Rodríguez B, Erinjeri AP, Rodríguez-Palero MJ, Millar V, González-Hernández S, Olmedo M, Schulze B, Baumeister R, Muñoz MJ, Askjaer P, Artal-Sanz M.
Combined flow cytometry and high-throughput image analysis for the study of essential genes in Caenorhabditis elegans.
BMC Biol. 2018 16(1) 36 
[ PubMed ID = 29598825 ] [ RRC reference ]

Artal-Sanz M, Tavernarakis N.
Prohibitin couples diapause signalling to mitochondrial metabolism during ageing in C. elegans.
Nature 2009 461(7265) 793-7 
[ PubMed ID = 19812672 ] [ RRC reference ]