Home > Mutants (Isolated) > tm2564

Mutants (Isolated)

Allele Name		tm2564
Allele Type		Normal
Sequence Name		K02E10.1
Gene Name		K02E10.1
Worm Base	Allele Name	tm2564
	Gene Name	K02E10.1
	Sequence	K02E10.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		20111/20112-20397/20398 (286 bp deletion)
Chromosome		X
Putative gene structure		join(19419..19442, 20177..20314, 20575..20799, 22297..22369, 23382..23479, 23551..23649)
Map position		-14.87
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GTTAGGTACACTACACAAGC,IntFwd:TGTGTATGCCAAATGCGCGT,ExtRev:GCACCTACGCATCGCATCTA,IntRev:ACGGCAACACGTGGTATATG
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Yoshida K, Suehiro Y, Dejima K, Yoshina S, Mitani S. Distinct pathways for export of silencing RNA in Caenorhabditis elegans systemic RNAi. iScience 2023 26(10) 108067  [ PubMed ID = 37854694 ] [ RRC reference ] Haley R, Wang Y, Zhou Z. The small GTPase RAB-35 defines a third pathway that is required for the recognition and degradation of apoptotic cells. PLoS Genet 2018 14(8) e1007558  [ PubMed ID = 30138370 ] [ RRC reference ] Harris GP, Hapiak VM, Wragg RT, Miller SB, Hughes LJ, Hobson RJ, Steven R, Bamber B, Komuniecki RW. Three distinct amine receptors operating at different levels within the locomotory circuit are each essential for the serotonergic modulation of chemosensation in Caenorhabditis elegans. J Neurosci 2009 29(5) 1446-56  [ PubMed ID = 19193891 ] [ RRC reference ] Hapiak VM, Hobson RJ, Hughes L, Smith K, Harris G, Condon C, Komuniecki P, Komuniecki RW. Dual excitatory and inhibitory serotonergic inputs modulate egg laying in Caenorhabditis elegans. Genetics 2009 181(1) 153-63  [ PubMed ID = 19001289 ] [ RRC reference ]