Mutants (Isolated)

tm2560

Allele Nametm2560
Sequence NameZK84.3
CGC Nameins-5
Worm BaseAllele Name tm2560
CGC Name ins-5
Sequence ZK84.3
Phenotypehomozygous viable. Dr. T. Katada: No abnormal proliferation in Z2/Z3 cells during L1 diapause. Dr. M. Driscoll: normal dauer formation. Dr. P.W. Sternberg: normal locomotion. Dr. J. Kaplan: slight increase in Nile Red staining.
Mutation site1996/1997-CAT-2253/2254 (257 bp deletion + 3 bp insertion)
ChromosomeII
Putative gene structurejoin(2002..2216, 2267..2306)
Map position-0.71
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCTCCTTGCGCCATGATGT,IntFwd:GCTCCTCCCATGTTGGATTG,ExtRev:ATCCTTGAATGCCCGTGAGT,IntRev:GGTTTCAGGAGGGTGACGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Baugh LR, Kurhanewicz N, Sternberg PW.
Sensitive and precise quantification of insulin-like mRNA expression in Caenorhabditis elegans.
PLoS ONE 2011 6(3) e18086 
[ PubMed ID = 21445366 ] [ RRC reference ]

Fukuyama M, Kontani K, Katada T, Rougvie AE.
The C. elegans Hypodermis Couples Progenitor Cell Quiescence to the Dietary State.
Curr. Biol. 2015 25(9) 1241-8 
[ PubMed ID = 25891400 ] [ RRC reference ]

Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR.
Insulin-like signalling to the maternal germline controls progeny response to osmotic stress.
Nat. Cell Biol. 2017 19(3) 252-257 
[ PubMed ID = 28166192 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem. Biophys. Res. Commun. 2017 484(2) 323-330 
[ PubMed ID = 28131836 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev. Biol. 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79 
[ PubMed ID = 24671950 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J. 2013 32(12) 1745-60 
[ PubMed ID = 23665919 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet. 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]