Mutants (Isolated)

tm2553

Allele Nametm2553
Sequence NameY47D3A.21
CGC NameY47D3A.21
Worm BaseAllele Name tm2553
CGC Name Y47D3A.21
Sequence Y47D3A.21
Phenotypelethal or sterile
Mutation site142555/142556-142677/142678 (122 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(140633..140817, 141944..142246, 142676..142766))
Map position8.24
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:AGTGGCGAGACCCTTAATAA,IntFwd:GCGAGACCCTTAATAACAGT,ExtRev:ATCTCTGGCTCCAGGGCCAA,IntRev:CCAGGGCCAATTGATGGAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Baudrimont A, Penkner A, Woglar A, Mamnun YM, Hulek M, Struck C, Schnabel R, Loidl J, Jantsch V.
A new thermosensitive smc-3 allele reveals involvement of cohesin in homologous recombination in C. elegans.
PLoS One 2011 6(9) e24799 
[ PubMed ID = 21957461 ] [ RRC reference ]