Mutants (Isolated)

tm2549

Allele Nametm2549
Sequence NameC27A12.8
CGC Nameari-1
Worm BaseAllele Name tm2549
CGC Name ari-1
Sequence C27A12.8
Phenotypehomozygous viable. Dr. W. Vermeulen: not sensitive to UV-irradiation.
Mutation site23395/23396-24218/24219 (823 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(22333..22431, 22508..22780, 22831..23271, 23317..23442, 23634..24026, 24070..24156, 24367..24432))
Map position0.71
Balancer
Map position of balancer
Sequence of primersExtFwd:CCTTCGGAACAATGGTCTAG,IntFwd:CGATGTTCTACGTATCGGTA,ExtRev:ATATGGACGACAGTGACTCA,IntRev:CGACAGTGACTCAAGTCAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mani K, Fay DS.
A mechanistic basis for the coordinated regulation of pharyngeal morphogenesis in Caenorhabditis elegans by LIN-35/Rb and UBC-18-ARI-1.
PLoS Genet. 2009 5(6) e1000510 
[ PubMed ID = 19521497 ] [ RRC reference ]

Polley SR, Kuzmanov A, Kuang J, Karpel J, Lažetić V, Karina EI, Veo BL, Fay DS.
Implicating SCF complexes in organogenesis in Caenorhabditis elegans.
Genetics 2014 196(1) 211-23 
[ PubMed ID = 24214340 ] [ RRC reference ]

Fay DS, Polley SR, Kuang J, Kuzmanov A, Hazel JW, Mani K, Veo BL, Yochem J.
A regulatory module controlling pharyngeal development and function in Caenorhabditis elegans.
Genetics 2012 191(3) 827-43 
[ PubMed ID = 22542967 ] [ RRC reference ]