Mutants (Isolated)

tm2547

Allele Nametm2547
Sequence NameF35D2.4
CGC Namemks-3
Worm BaseAllele Name tm2547
CGC Name mks-3
Sequence F35D2.4
Phenotypehomozygous viable. Dr. P. Swoboda: Dyf(+), Osm(+). Dr.K. Oegema: wild-type dyf.
Mutation site18469/18470-19418/19419 (949 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(17044..17370, 17421..17532, 17587..17761, 17803..18019, 18294..18572, 18620..19028, 19090..19304, 19352..19486, 19540..19742, 19806..19927, 20008..20057))
Map position0.5
Balancer
Map position of balancer
Sequence of primersExtRev:CCGCACAACATCACCATGAC,IntRev:ACCATGACAACGTGGTTCGT,ExtFwd:GGTTCCTCATGTATTGGCCA,IntFwd:TGGCCAAACATGCCTGTCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Williams CL, Masyukova SV, Yoder BK.
Normal ciliogenesis requires synergy between the cystic kidney disease genes MKS-3 and NPHP-4.
J. Am. Soc. Nephrol. 2010 21(5) 782-93 
[ PubMed ID = 20150540 ] [ RRC reference ]

Yee LE, Garcia-Gonzalo FR, Bowie RV, Li C, Kennedy JK, Ashrafi K, Blacque OE, Leroux MR, Reiter JF.
Conserved Genetic Interactions between Ciliopathy Complexes Cooperatively Support Ciliogenesis and Ciliary Signaling.
PLoS Genet. 2015 11(11) e1005627 
[ PubMed ID = 26540106 ] [ RRC reference ]

Huang L, Szymanska K, Jensen VL, Janecke AR, Innes AM, Davis EE, Frosk P, Li C, Willer JR, Chodirker BN, Greenberg CR, McLeod DR, Bernier FP, Chudley AE, Müller T, Shboul M, Logan CV, Loucks CM, Beaulieu CL, Bowie RV, Bell SM, Adkins J, Zuniga FI, Ross KD, Wang J, Ban MR, Becker C, Nürnberg P, Douglas S, Craft CM, Akimenko MA, Hegele RA, Ober C, Utermann G, Bolz HJ, Bulman DE, Katsanis N, Blacque OE, Doherty D, Parboosingh JS, Leroux MR, Johnson CA, Boycott KM.
TMEM237 is mutated in individuals with a Joubert syndrome related disorder and expands the role of the TMEM family at the ciliary transition zone.
Am. J. Hum. Genet. 2011 89(6) 713-30 
[ PubMed ID = 22152675 ] [ RRC reference ]

Jensen VL, Carter S, Sanders AA, Li C, Kennedy J, Timbers TA, Cai J, Scheidel N, Kennedy BN, Morin RD, Leroux MR, Blacque OE.
Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport.
PLoS Genet. 2016 12(12) e1006469 
[ PubMed ID = 27930654 ] [ RRC reference ]

Warburton-Pitt SR, Jauregui AR, Li C, Wang J, Leroux MR, Barr MM.
Ciliogenesis in Caenorhabditis elegans requires genetic interactions between ciliary middle segment localized NPHP-2 (inversin) and transition zone-associated proteins.
J. Cell. Sci. 2012 125(Pt 11) 2592-603 
[ PubMed ID = 22393243 ] [ RRC reference ]