Mutants (Isolated)

tm2543

Allele Nametm2543
Sequence NameY73B6BL.2
CGC Namehtp-2
Worm BaseAllele Name tm2543
CGC Name htp-2
Sequence Y73B6BL.2
Phenotypehomozygous viable. Dr. A. Dernburg: very weak Him (~1%). Dr. E. Marinez-Perez: Genes & Dev. 22, 2886 (2008).
Mutation site133607/133608-GGCTGTTCTC-133766/133767 (159 bp deletion + 10 bp insertion)
ChromosomeIV
Putative gene structurejoin(133377..133466, 133512..133659, 133706..134439, 134489..134599)
Map position3.2
Balancer
Map position of balancer
Sequence of primersIntFwd:GACCCGGATCGATCGTCCAA,ExtFwd:AGCATTGTCAGCGACCCGGA,IntRev:TCGAAGCCATCGATGCGGAA,ExtRev:GGTGACCGATTGGATACCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Martinez-Perez E, Schvarzstein M, Barroso C, Lightfoot J, Dernburg AF, Villeneuve AM.
Crossovers trigger a remodeling of meiotic chromosome axis composition that is linked to two-step loss of sister chromatid cohesion.
Genes Dev. 2008 22(20) 2886-901 
[ PubMed ID = 18923085 ] [ RRC reference ]

Roelens B, Schvarzstein M, Villeneuve AM.
Manipulation of Karyotype in Caenorhabditis elegans Reveals Multiple Inputs Driving Pairwise Chromosome Synapsis During Meiosis.
Genetics 2015 201(4) 1363-79 
[ PubMed ID = 26500263 ] [ RRC reference ]

Schvarzstein M, Pattabiraman D, Bembenek JN, Villeneuve AM.
Meiotic HORMA domain proteins prevent untimely centriole disengagement during Caenorhabditis elegans spermatocyte meiosis.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(10) E898-907 
[ PubMed ID = 23401519 ] [ RRC reference ]

Ferrandiz N, Barroso C, Telecan O, Shao N, Kim HM, Testori S, Faull P, Cutillas P, Snijders AP, Colaiácovo MP, Martinez-Perez E.
Spatiotemporal regulation of Aurora B recruitment ensures release of cohesion during C. elegans oocyte meiosis.
Nat Commun 2018 9(1) 834 
[ PubMed ID = 29483514 ] [ RRC reference ]

Kim Y, Kostow N, Dernburg AF.
The Chromosome Axis Mediates Feedback Control of CHK-2 to Ensure Crossover Formation in C. elegans.
Dev. Cell 2015 35(2) 247-61 
[ PubMed ID = 26506311 ] [ RRC reference ]

Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N.
Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans.
Genetics 2016 204(3) 987-997 
[ PubMed ID = 27605049 ] [ RRC reference ]