Mutants (Isolated)

tm2542

Allele Nametm2542
Sequence NameF23H11.9
CGC Namecrls-1
Worm BaseAllele Name tm2542
CGC Name crls-1
Sequence F23H11.9
Phenotypelethal or sterile
Mutation site13390/13391-13758/13759 (368 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(12653..12823, 13250..13404, 13450..13579, 13827..14111))
Map position-25.36
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:CCAATACCATGTTCGTGCCA,IntFwd:CTGAGGGAATATGGTGGACT,ExtRev:ATCGCTAATGTTACTGCGGA,IntRev:TCGTGGTATTGCTTGCCGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sakamoto T, Inoue T, Otomo Y, Yokomori N, Ohno M, Arai H, Nakagawa Y.
Deficiency of cardiolipin synthase causes abnormal mitochondrial function and morphology in germ cells of Caenorhabditis elegans.
J. Biol. Chem. 2012 287(7) 4590-601 
[ PubMed ID = 22174409 ] [ RRC reference ]