Mutants (Isolated)

tm2536

Allele Nametm2536
Sequence NameR153.1
CGC Namepde-4
Worm BaseAllele Name tm2536
CGC Name pde-4
Sequence R153.1
Phenotypehomozygous viable. Dr. A. Chisholm: normal touch neuron morphology.
Mutation site4035/4036-4269/4270 (234 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(3170..3346, 3458..3640, 3693..3815, 4034..4188, 4597..4696, 4748..5170, 5989..6129, 7364..7440, 7858..7960, 8811..8904, 16727..16903, 24891..24976))
Map position0.51
Balancer
Map position of balancer
Sequence of primersExtFwd:TGTACCCACACGTGATCAAC,IntFwd:CCGGTCCTTCATCTCTTTAT,ExtRev:GGTACAAGGCCCTTCTACAT,IntRev:AGCTCAAACAGCAGCCATGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ghosh-Roy A, Wu Z, Goncharov A, Jin Y, Chisholm AD.
Calcium and cyclic AMP promote axonal regeneration in Caenorhabditis elegans and require DLK-1 kinase.
J. Neurosci. 2010 30(9) 3175-83 
[ PubMed ID = 20203177 ] [ RRC reference ]