Mutants (Isolated)

tm2535

Allele Nametm2535
Sequence NameT09A12.2a
CGC NameT09A12.2
Worm BaseAllele Name tm2535
CGC Name T09A12.2
Sequence T09A12.2a
Phenotypehomozygous viable. Dr. H. Sawa: not Psa. Dr. O. Blacque: WT Dyf phenotype.
Mutation site8870/8871-C-9092/9093 (222 bp deletion + 1 bp insertion)
ChromosomeIV
Putative gene structurejoin(8353..8501, 8961..9189)
Map position3.68
Balancer
Map position of balancer
Sequence of primersExtFwd:CCGGCTGATCTCTTCTTCCA,ExtRev:CTGACCATTTACCTCGATCT,IntFwd:CTGCCTTTTAAGGCAACCGA,IntRev:AACCGTATGTGCCTTGATAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sakamoto T, Maebayashi K, Nakagawa Y, Imai H.
Deletion of the four phospholipid hydroperoxide glutathione peroxidase genes accelerates aging in Caenorhabditis elegans.
Genes Cells 2014 19(10) 778-92 
[ PubMed ID = 25200408 ] [ RRC reference ]

Han Y, Song S, Wu H, Zhang J, Ma E.
Antioxidant enzymes and their role in phoxim and carbaryl stress in Caenorhabditis elegans.
Pestic Biochem Physiol 2017 138 43-50 
[ PubMed ID = 28456303 ] [ RRC reference ]

Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]

Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS ONE 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]