Mutants (Isolated)

tm2530

Allele Nametm2530
Sequence NameY51H1A.4
CGC Nameing-3
Worm BaseAllele Name tm2530
CGC Name ing-3
Sequence Y51H1A.4
Phenotypehomozygous viable
Mutation site21827/21828-22792/22793 (965 bp deletion)
ChromosomeII
Putative gene structurejoin(19135..19162, 19229..19300, 19354..19457, 20843..21367, 22500..23114, 25209..25337)
Map position20.7
Balancer
Map position of balancer
Sequence of primersIntRev:GCCCACACTAACATGACGAT,ExtRev:TCGCACTATTTCTGCTGGGA,IntFwd:GCGTGCTAGCTCAACGCAAA,ExtFwd:CTCCACAATCCGCGTGCTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wohlschlager T, Butschi A, Grassi P, Sutov G, Gauss R, Hauck D, Schmieder SS, Knobel M, Titz A, Dell A, Haslam SM, Hengartner MO, Aebi M, K├╝nzler M.
Methylated glycans as conserved targets of animal and fungal innate defense.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(27) E2787-96 
[ PubMed ID = 24879441 ] [ RRC reference ]

Luo J, Shah S, Riabowol K, Mains PE.
The Caenorhabditis elegans ing-3 gene regulates ionizing radiation-induced germ-cell apoptosis in a p53-associated pathway.
Genetics 2009 181(2) 473-82 
[ PubMed ID = 19015549 ] [ RRC reference ]

Mariani L, Lussi YC, Vandamme J, Riveiro A, Salcini AE.
The H3K4me3/2 histone demethylase RBR-2 controls axon guidance by repressing the actin-remodeling gene wsp-1.
Development 2016 143(5) 851-63 
[ PubMed ID = 26811384 ] [ RRC reference ]