Mutants (Isolated)

tm2526

Allele Nametm2526
Sequence NameD1037.4
CGC Namerab-8
Worm BaseAllele Name tm2526
CGC Name rab-8
Sequence D1037.4
Phenotypehomozygous viable. Dr. O. Blacque: dye-filling normal. Dr. K. Sato: Nature448, 366 (2007). Dr. S. Eimer: normal levamisole receptor trafficking. Dr. H.C. Korswagen: no QL migration defect or ALM/PLM polarity defects.
Mutation site22868/22869-23109/23110 (241 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(22559..22948, 23008..23068, 23116..23270, 23318..23347))
Map position-2.95
Balancer
Map position of balancer
Sequence of primersIntFwd:CTTCTTCTGTGTCCCCGATC,ExtFwd:TATGCGAGAGAGAGCGGACA,IntRev:CTTTTGCATGCCAAGATGTC,ExtRev:CCGGGACCCATCAGTGTCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sato T, Mushiake S, Kato Y, Sato K, Sato M, Takeda N, Ozono K, Miki K, Kubo Y, Tsuji A, Harada R, Harada A.
The Rab8 GTPase regulates apical protein localization in intestinal cells.
Nature 2007 448(7151) 366-9 
[ PubMed ID = 17597763 ] [ RRC reference ]

Mukhopadhyay S, Lu Y, Shaham S, Sengupta P.
Sensory signaling-dependent remodeling of olfactory cilia architecture in C. elegans.
Dev. Cell 2008 14(5) 762-74 
[ PubMed ID = 18477458 ] [ RRC reference ]

Shi A, Liu O, Koenig S, Banerjee R, Chen CC, Eimer S, Grant BD.
RAB-10-GTPase-mediated regulation of endosomal phosphatidylinositol-4,5-bisphosphate.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(35) E2306-15 
[ PubMed ID = 22869721 ] [ RRC reference ]

Kaplan OI, Doroquez DB, Cevik S, Bowie RV, Clarke L, Sanders AA, Kida K, Rappoport JZ, Sengupta P, Blacque OE.
Endocytosis genes facilitate protein and membrane transport in C. elegans sensory cilia.
Curr. Biol. 2012 22(6) 451-60 
[ PubMed ID = 22342749 ] [ RRC reference ]

Kaplan OI, Molla-Herman A, Cevik S, Ghossoub R, Kida K, Kimura Y, Jenkins P, Martens JR, Setou M, Benmerah A, Blacque OE.
The AP-1 clathrin adaptor facilitates cilium formation and functions with RAB-8 in C. elegans ciliary membrane transport.
J. Cell. Sci. 2010 123(Pt 22) 3966-77 
[ PubMed ID = 20980383 ] [ RRC reference ]

Olivier-Mason A, Wojtyniak M, Bowie RV, Nechipurenko IV, Blacque OE, Sengupta P.
Transmembrane protein OSTA-1 shapes sensory cilia morphology via regulation of intracellular membrane trafficking in C. elegans.
Development 2013 140(7) 1560-72 
[ PubMed ID = 23482491 ] [ RRC reference ]

Zou W, Yadav S, DeVault L, Nung Jan Y, Sherwood DR.
RAB-10-Dependent Membrane Transport Is Required for Dendrite Arborization.
PLoS Genet. 2015 11(9) e1005484 
[ PubMed ID = 26394140 ] [ RRC reference ]

Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J. Cell. Sci. 2013 126(Pt 19) 4381-95 
[ PubMed ID = 23886944 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84 
[ PubMed ID = 24646679 ] [ RRC reference ]

Laurent P, Ch'ng Q, Jospin M, Chen C, Lorenzo R, de Bono M.
Genetic dissection of neuropeptide cell biology at high and low activity in a defined sensory neuron.
Proc. Natl. Acad. Sci. U.S.A. 2018 115(29) E6890-E6899 
[ PubMed ID = 29959203 ] [ RRC reference ]