Mutants (Isolated)

tm2525

Allele Nametm2525
Sequence NameR153.1
CGC Namepde-4
Worm BaseAllele Name tm2525
CGC Name pde-4
Sequence R153.1
Phenotypehomozygous viable. Dr. A. Chisholm: normal touch neuron morphology.
Mutation site4129/4130-4457/4458 (328 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(3170..3346, 3458..3640, 3693..3815, 4034..4188, 4597..4696, 4748..5170, 5989..6129, 7364..7440, 7858..7960, 8811..8904, 16727..16903, 24891..24976))
Map position0.51
Balancer
Map position of balancer
Sequence of primersExtFwd:TGTACCCACACGTGATCAAC,IntFwd:CCGGTCCTTCATCTCTTTAT,ExtRev:GGTACAAGGCCCTTCTACAT,IntRev:AGCTCAAACAGCAGCCATGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sakamoto T, Maebayashi K, Nakagawa Y, Imai H.
Deletion of the four phospholipid hydroperoxide glutathione peroxidase genes accelerates aging in Caenorhabditis elegans.
Genes Cells 2014 19(10) 778-92 
[ PubMed ID = 25200408 ] [ RRC reference ]