Home > Mutants (Isolated) > tm2523

Mutants (Isolated)

Allele Name		tm2523
Allele Type		Balanced
Sequence Name		F25B3.1
Gene Name		ehbp-1
Worm Base	Allele Name	tm2523
	Gene Name	ehbp-1
	Sequence	F25B3.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile. Dr. H. Bellen: Ste and Sck.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		1245/1246-1748/1749 (503 bp deletion)
Chromosome		V
Putative gene structure		join(Z70750.1:35823..35897, Z70750.1:35940..36004, 110..564, 616..744, 1065..1284, 1334..2021, 2472..2637, 2738..2815, 2894..2953, 3047..3108, 3731..3850, 3965..4120, 4169..4482, 4740..4857)
Map position		2.05
Balancer		nT1,nT1 [qIs51]
Map position of balancer
Sequence of primers		ExtRev:ACTCCTGGAGTCACCATGGT,IntRev:GTCACCATGGTTATGCTTAC,ExtFwd:ACCGACACCCGTGGCTCTTA,IntFwd:CCGTGGCTCTTATAGAATGT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Wang P, Liu H, Wang Y, Liu O, Zhang J, Gleason A, Yang Z, Wang H, Shi A, Grant BD. RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes. PLoS Genet 2016 12(6) e1006093  [ PubMed ID = 27272733 ] [ RRC reference ] Wang P, Liu H, Wang Y, Liu O, Zhang J, Gleason A, Yang Z, Wang H, Shi A, Grant BD. RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes. PLoS Genet 2016 12(6) e1006093  [ PubMed ID = 27272733 ] [ RRC reference ] Liu H, Wang S, Hang W, Gao J, Zhang W, Cheng Z, Yang C, He J, Zhou J, Chen J, Shi A. LET-413/Erbin acts as a RAB-5 effector to promote RAB-10 activation during endocytic recycling. J Cell Biol 2018 217(1) 299-314  [ PubMed ID = 29079669 ] [ RRC reference ] Shi A, Chen CC, Banerjee R, Glodowski D, Audhya A, Rongo C, Grant BD. EHBP-1 functions with RAB-10 during endocytic recycling in Caenorhabditis elegans. Mol Biol Cell 2010 21(16) 2930-43  [ PubMed ID = 20573983 ] [ RRC reference ]