Mutants (Isolated)

tm2523

Allele Nametm2523
Sequence NameF25B3.1
CGC Nameehbp-1
Worm BaseAllele Name tm2523
CGC Name ehbp-1
Sequence F25B3.1
Phenotypelethal or sterile. Dr. H. Bellen: Ste and Sck.
Mutation site1245/1246-1748/1749 (503 bp deletion)
ChromosomeV
Putative gene structurejoin(Z70750.1:35823..35897, Z70750.1:35940..36004, 110..564, 616..744, 1065..1284, 1334..2021, 2472..2637, 2738..2815, 2894..2953, 3047..3108, 3731..3850, 3965..4120, 4169..4482, 4740..4857)
Map position2.05
BalancernT1
Map position of balancer
Sequence of primersExtRev:ACTCCTGGAGTCACCATGGT,IntRev:GTCACCATGGTTATGCTTAC,ExtFwd:ACCGACACCCGTGGCTCTTA,IntFwd:CCGTGGCTCTTATAGAATGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Shi A, Chen CC, Banerjee R, Glodowski D, Audhya A, Rongo C, Grant BD.
EHBP-1 functions with RAB-10 during endocytic recycling in Caenorhabditis elegans.
Mol. Biol. Cell 2010 21(16) 2930-43 
[ PubMed ID = 20573983 ] [ RRC reference ]

Wang P, Liu H, Wang Y, Liu O, Zhang J, Gleason A, Yang Z, Wang H, Shi A, Grant BD.
RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes.
PLoS Genet. 2016 12(6) e1006093 
[ PubMed ID = 27272733 ] [ RRC reference ]

Wang P, Liu H, Wang Y, Liu O, Zhang J, Gleason A, Yang Z, Wang H, Shi A, Grant BD.
RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes.
PLoS Genet. 2016 12(6) e1006093 
[ PubMed ID = 27272733 ] [ RRC reference ]

Liu H, Wang S, Hang W, Gao J, Zhang W, Cheng Z, Yang C, He J, Zhou J, Chen J, Shi A.
LET-413/Erbin acts as a RAB-5 effector to promote RAB-10 activation during endocytic recycling.
J. Cell Biol. 2018 217(1) 299-314 
[ PubMed ID = 29079669 ] [ RRC reference ]