Mutants (Isolated)

tm2516

Allele Nametm2516
Sequence NameW04H10.3
CGC Namenhl-3
Worm BaseAllele Name tm2516
CGC Name nhl-3
Sequence W04H10.3
Phenotypehomozygous viable
Mutation site2263/2264-2500/2501 (237 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(100..249, 303..399, 556..950, 1533..1767, 2252..2443, 2571..2839, 3031..3162, 4689..4878, 5229..5341, 5502..5618, 5900..5983, 6794..6895))
Map position-15.59
Balancer
Map position of balancer
Sequence of primersExtRev:GCCCCTTTCCTGGTTATACG,IntFwd:CTCTGTAGTTTGTACTCTGG,IntRev:TACTTATCGAAACCGTCCGT,ExtFwd:TGGTGCCAGAGTGTCCTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hyenne V, Desrosiers M, Labbé JC.
C. elegans Brat homologs regulate PAR protein-dependent polarity and asymmetric cell division.
Dev. Biol. 2008 321(2) 368-78 
[ PubMed ID = 18652816 ] [ RRC reference ]

Hammell CM, Lubin I, Boag PR, Blackwell TK, Ambros V.
nhl-2 Modulates microRNA activity in Caenorhabditis elegans.
Cell 2009 136(5) 926-38 
[ PubMed ID = 19269369 ] [ RRC reference ]