Mutants (Isolated)

tm2510

Allele Nametm2510
Sequence NameT01C2.1
CGC Nameacy-4
Worm BaseAllele Name tm2510
CGC Name acy-4
Sequence T01C2.1
Phenotypelethal or sterile. Dr. D. Greenstein: Ste (Herm: defects in oocyte meiotic maturation, Male: defects in mating behavior)
Mutation site4863/4864-5168/5169 (305 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(18..161, 423..659, 708..1070, 1121..1238, 1297..1376, 1423..1554, 1604..1687, 2100..2267, 2310..2522, 2568..2766, 3271..3669, 4161..4331, 4373..4473, 4655..4747, 4802..4879, 5084..5264, 5857..5960))
Map position-1.33
BalancernT1
Map position of balancer
Sequence of primersIntFwd:TTACATGCCACATCGGTCAT,ExtFwd:AGCTGTCAATTGCCGAAGGT,IntRev:GACCACAAATAGTTACGCTG,ExtRev:TTGGAGTTCCGGTGGATTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Govindan JA, Nadarajan S, Kim S, Starich TA, Greenstein D.
Somatic cAMP signaling regulates MSP-dependent oocyte growth and meiotic maturation in C. elegans.
Development 2009 136(13) 2211-21 
[ PubMed ID = 19502483 ] [ RRC reference ]