Mutants (Isolated)

tm2502

Allele Nametm2502
Sequence NameM6.1
CGC Nameifc-2
Worm BaseAllele Name tm2502
CGC Name ifc-2
Sequence M6.1
Phenotypehomozygous viable. Dr. H. Sawa: non-Psa.
Mutation site26083/26084-26553/26554 (470 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(22390..23297, 23346..23504, 23553..23720, 23772..24266, 24353..24463, 24713..24876, 25450..25552, 25602..26261, 26531..26622, 26719..26971, 27017..27135, 27634..27794, 28033..28249, 28299..28409, 28616..28751, 29271..29352, 5729..5760, 6607..6709, 8417..8530))
Map position-19.52
Balancer
Map position of balancer
Sequence of primersExtFwd:CTGACTCTCTCAGGCGGTTG,ExtRev:ACTCCGAATCGATCCGCCAT,IntFwd:GCGGTTGTGATCTGTCTCTC,IntRev:GTTTACTCACCAGGCGGCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hüsken K, Wiesenfahrt T, Abraham C, Windoffer R, Bossinger O, Leube RE.
Maintenance of the intestinal tube in Caenorhabditis elegans: the role of the intermediate filament protein IFC-2.
Differentiation 2008 76(8) 881-96 
[ PubMed ID = 18452552 ] [ RRC reference ]