Mutants (Isolated)

tm2486

Allele Nametm2486
Sequence NameY47H9C.6
CGC Namecsp-3
Worm BaseAllele Name tm2486
CGC Name csp-3
Sequence Y47H9C.6
Phenotypehomozygous viable
Mutation site58027/58028-58740/58741 (713 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(58017..58073, 58116..58352, 58397..58522))
Map position12.87
Balancer
Map position of balancer
Sequence of primersExtRev:CGCCTCAAACGCCACTGGAT,IntRev:CGCCACTGGATTCTCTGGTA,IntFwd:ATTCATCGTAGCAGCGGGAA,ExtFwd:GCTAGCATGACATCGTCACA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Huang CY, Chen JY, Wu SC, Tan CH, Tzeng RY, Lu PJ, Wu YF, Chen RH, Wu YC.
C. elegans EIF-3.K promotes programmed cell death through CED-3 caspase.
PLoS One 2012 7(5) e36584 
[ PubMed ID = 22590572 ] [ RRC reference ]

Geng X, Shi Y, Nakagawa A, Yoshina S, Mitani S, Shi Y, Xue D.
Inhibition of CED-3 zymogen activation and apoptosis in Caenorhabditis elegans by caspase homolog CSP-3.
Nat Struct Mol Biol 2008 15(10) 1094-101 
[ PubMed ID = 18776901 ] [ RRC reference ]