Mutants (Isolated)

tm2486

Allele Nametm2486
Sequence NameY47H9C.6
CGC Namecsp-3
Worm BaseAllele Name tm2486
CGC Name csp-3
Sequence Y47H9C.6
Phenotypehomozygous viable
Mutation site58027/58028-58740/58741 (713 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(58017..58073, 58116..58352, 58397..58522))
Map position12.87
Balancer
Map position of balancer
Sequence of primersExtRev:CGCCTCAAACGCCACTGGAT,IntRev:CGCCACTGGATTCTCTGGTA,IntFwd:ATTCATCGTAGCAGCGGGAA,ExtFwd:GCTAGCATGACATCGTCACA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Geng X, Shi Y, Nakagawa A, Yoshina S, Mitani S, Shi Y, Xue D.
Inhibition of CED-3 zymogen activation and apoptosis in Caenorhabditis elegans by caspase homolog CSP-3.
Nat. Struct. Mol. Biol. 2008 15(10) 1094-101 
[ PubMed ID = 18776901 ] [ RRC reference ]

Huang CY, Chen JY, Wu SC, Tan CH, Tzeng RY, Lu PJ, Wu YF, Chen RH, Wu YC.
C. elegans EIF-3.K promotes programmed cell death through CED-3 caspase.
PLoS ONE 2012 7(5) e36584 
[ PubMed ID = 22590572 ] [ RRC reference ]