Mutants (Isolated)

tm2472

Allele Nametm2472
Sequence NameY57G11C.13
CGC Namearl-8
Worm BaseAllele Name tm2472
CGC Name arl-8
Sequence Y57G11C.13
Phenotypehomozygous viable
Mutation site161854/161855-161957/161958 (103 bp deletion)
ChromosomeIV
Putative gene structurejoin(160907..161029, 161078..161465, 161513..161559)
Map position12.52
Balancer
Map position of balancer
Sequence of primersIntRev:ATTAGGCTGCAATGCTAGAG,ExtRev:GCAACAGTTCCCGAATCGCT,ExtFwd:CGCTATTCCAGTTTTGGTGC,IntFwd:CAAGAAGGATTTGCCTGGAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Fischer SE, Pan Q, Breen PC, Qi Y, Shi Z, Zhang C, Ruvkun G.
Multiple small RNA pathways regulate the silencing of repeated and foreign genes in C. elegans.
Genes Dev. 2013 27(24) 2678-95 
[ PubMed ID = 24352423 ] [ RRC reference ]