Mutants (Isolated)

tm2469

Allele Nametm2469
Allele TypeBalanced
Sequence NameR08C7.3
Gene Namehtz-1
Worm BaseAllele Name tm2469
Gene Name htz-1
Sequence R08C7.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. W.G. Kelly: fertile and histone methylation on the male X chromosome is normal. Dr. H. Sawa: no Psa phenotype. Dr. M. Han: Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 25290/25291-25635/25636 (345 bp deletion)
ChromosomeIV
Putative gene structurejoin(25174..25343, 25394..25646)
Map position0.28
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:GCGTGCCAAAAAGGAGGAGT,IntFwd:GCGCGCTTTTGAGAGTTGAT,ExtRev:CGCCTATTGGGGAGTGATAG,IntRev:CCAGCATTTATTGTGGTCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Negishi T, Kitagawa S, Horii N, Tanaka Y, Haruta N, Sugimoto A, Sawa H, Hayashi KI, Harata M, Kanemaki MT.
The auxin-inducible degron 2 (AID2) system enables controlled protein knockdown during embryogenesis and development in Caenorhabditis elegans.
Genetics 2022 220(2)  
[ PubMed ID = 34865044 ] [ RRC reference ]

Wagner CR, Kuervers L, Baillie DL, Yanowitz JL.
xnd-1 regulates the global recombination landscape in Caenorhabditis elegans.
Nature 2010 467(7317) 839-43 
[ PubMed ID = 20944745 ] [ RRC reference ]

Petty E, Laughlin E, Csankovszki G.
Regulation of DCC localization by HTZ-1/H2A.Z and DPY-30 does not correlate with H3K4 methylation levels.
PLoS One 2011 6(10) e25973 
[ PubMed ID = 21998734 ] [ RRC reference ]

Shibata Y, Sawa H, Nishiwaki K.
HTZ-1/H2A.z and MYS-1/MYST HAT act redundantly to maintain cell fates in somatic gonadal cells through repression of ceh-22 in C. elegans.
Development 2014 141(1) 209-18 
[ PubMed ID = 24346701 ] [ RRC reference ]

Petty EL, Collette KS, Cohen AJ, Snyder MJ, Csankovszki G.
Restricting dosage compensation complex binding to the X chromosomes by H2A.Z/HTZ-1.
PLoS Genet 2009 5(10) e1000699 
[ PubMed ID = 19851459 ] [ RRC reference ]

Whittle CM, McClinic KN, Ercan S, Zhang X, Green RD, Kelly WG, Lieb JD.
The genomic distribution and function of histone variant HTZ-1 during C. elegans embryogenesis.
PLoS Genet 2008 4(9) e1000187 
[ PubMed ID = 18787694 ] [ RRC reference ]