Home > Mutants (Isolated) > tm2468

Mutants (Isolated)

Allele Name		tm2468
Allele Type		Normal
Sequence Name		F58E6.7
Gene Name		hrg-3
Worm Base	Allele Name	tm2468
	Gene Name	hrg-3
	Sequence	F58E6.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		17711/17712-17929/17930 (218 bp deletion)
Chromosome		V
Putative gene structure		join(17798..17878, 17928..17990, 18044..18112)
Map position		2.15
Balancer
Map position of balancer
Sequence of primers		ExtFwd:TTAACGGGGAGATTAGGATG,IntFwd:CGTATCTTCATTCTCCCGGA,ExtRev:GCAGCCATATCTTGGCAGTA,IntRev:ACGAGTCACTCGCAGTGATC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Okahata M, Wei AD, Ohta A, Kuhara A. Cold acclimation via the KQT-2 potassium channel is modulated by oxygen in Caenorhabditis elegans. Sci Adv 2019 5(2) eaav3631  [ PubMed ID = 30775442 ] [ RRC reference ] Hada K, Hirota K, Inanobe A, Kako K, Miyata M, Araoi S, Matsumoto M, Ohta R, Arisawa M, Daitoku H, Hanada T, Fukamizu A. Tricarboxylic acid cycle activity suppresses acetylation of mitochondrial proteins during early embryonic development in Caenorhabditis elegans. J Biol Chem 2019 294(9) 3091-3099  [ PubMed ID = 30606736 ] [ RRC reference ] Ohta A, Ujisawa T, Sonoda S, Kuhara A. Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans. Nat Commun 2014 5 4412  [ PubMed ID = 25048458 ] [ RRC reference ] Korolnek T, Zhang J, Beardsley S, Scheffer GL, Hamza I. Control of metazoan heme homeostasis by a conserved multidrug resistance protein. Cell Metab 2014 19(6) 1008-19  [ PubMed ID = 24836561 ] [ RRC reference ] Chen C, Samuel TK, Sinclair J, Dailey HA, Hamza I. An intercellular heme-trafficking protein delivers maternal heme to the embryo during development in C. elegans. Cell 2011 145(5) 720-31  [ PubMed ID = 21620137 ] [ RRC reference ]