Mutants (Isolated)

tm2467

Allele Nametm2467
Sequence NameY51H4A.12
CGC Nameset-26
Worm BaseAllele Name tm2467
CGC Name set-26
Sequence Y51H4A.12
Phenotypehomozygous viable
Mutation site178788/178789-179878/179875 (1090 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(175289..175332, 175464..175728, 176384..177177, 177711..177984, 178467..180302, 181241..182147, 183042..183382, 183470..183840, 183892..183997))
Map position15.14
Balancer
Map position of balancer
Sequence of primersExtFwd:AAGACGAGACCCTGGCAATG,IntFwd:TCGAATCGAAACCACGCCAG,ExtRev:CCGCCGAACTTCCTCCTCAA,IntRev:AAGCCTCCGACGCTCCTCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wang W, Chaturbedi A, Wang M, An S, Santhi Velayudhan S, Lee SS.
SET-9 and SET-26 are H3K4me3 readers and play critical roles in germline development and longevity.
Elife 2018 7  
[ PubMed ID = 29714684 ] [ RRC reference ]

Erdelyi P, Wang X, Suleski M, Wicky C.
A Network of Chromatin Factors Is Regulating the Transition to Postembryonic Development in Caenorhabditis elegans.
G3 (Bethesda) 2017 7(2) 343-353 
[ PubMed ID = 28007841 ] [ RRC reference ]

Bazopoulou D, Knoefler D, Zheng Y, Ulrich K, Oleson BJ, Xie L, Kim M, Kaufmann A, Lee YT, Dou Y, Chen Y, Quan S, Jakob U.
Developmental ROS individualizes organismal stress resistance and lifespan.
Nature 2019 576(7786) 301-305 
[ PubMed ID = 31801997 ] [ RRC reference ]

Hajduskova M, Baytek G, Kolundzic E, Gosdschan A, Kazmierczak M, Ofenbauer A, Beato Del Rosal ML, Herzog S, Ul Fatima N, Mertins P, Seelk-M├╝thel S, Tursun B.
MRG-1/MRG15 Is a Barrier for Germ Cell to Neuron Reprogramming in Caenorhabditis elegans.
Genetics 2019 211(1) 121-139 
[ PubMed ID = 30425042 ] [ RRC reference ]

Ni Z, Ebata A, Alipanahiramandi E, Lee SS.
Two SET domain containing genes link epigenetic changes and aging in Caenorhabditis elegans.
Aging Cell 2012 11(2) 315-25 
[ PubMed ID = 22212395 ] [ RRC reference ]