Mutants (Isolated)

tm2457

Allele Nametm2457
Sequence NameR74.3
CGC Namexbp-1
Worm BaseAllele Name tm2457
CGC Name xbp-1
Sequence R74.3
Phenotypehomozygous viable
Mutation site10614/10615-11303/11304 (689 bp deletion)
ChromosomeIII
Putative gene structurejoin(10193..10372, 10423..10901, 10956..11091)
Map position-3.7
Balancer
Map position of balancer
Sequence of primersExtRev:CTTGATGTGAAGAGGCTGCG ,ExtFwd:GCTTTAGCATATACCCTCAC,IntFwd:CCTGGGCTTTAGCCCCATAT,IntRev:GTAGTCCAGGCAAATAACGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Safra M, Ben-Hamo S, Kenyon C, Henis-Korenblit S.
The ire-1 ER stress-response pathway is required for normal secretory-protein metabolism in C. elegans.
J. Cell. Sci. 2013 126(Pt 18) 4136-46 
[ PubMed ID = 23843615 ] [ RRC reference ]

Henis-Korenblit S, Zhang P, Hansen M, McCormick M, Lee SJ, Cary M, Kenyon C.
Insulin/IGF-1 signaling mutants reprogram ER stress response regulators to promote longevity.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(21) 9730-5 
[ PubMed ID = 20460307 ] [ RRC reference ]

Safra M, Fickentscher R, Levi-Ferber M, Danino YM, Haviv-Chesner A, Hansen M, Juven-Gershon T, Weiss M, Henis-Korenblit S.
The FOXO transcription factor DAF-16 bypasses ire-1 requirement to promote endoplasmic reticulum homeostasis.
Cell Metab. 2014 20(5) 870-881 
[ PubMed ID = 25448701 ] [ RRC reference ]

Richardson CE, Kooistra T, Kim DH.
An essential role for XBP-1 in host protection against immune activation in C. elegans.
Nature 2010 463(7284) 1092-5 
[ PubMed ID = 20182512 ] [ RRC reference ]

Kozlowski L, Garvis S, Bedet C, Palladino F.
The Caenorhabditis elegans HP1 family protein HPL-2 maintains ER homeostasis through the UPR and hormesis.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(16) 5956-61 
[ PubMed ID = 24715729 ] [ RRC reference ]

Kyriakakis E, Charmpilas N, Tavernarakis N.
Differential adiponectin signalling couples ER stress with lipid metabolism to modulate ageing in C. elegans.
Sci Rep 2017 7(1) 5115 
[ PubMed ID = 28698593 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, B├╝low HE, Henis-Korenblit S.
It's all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans.
PLoS Genet. 2014 10(10) e1004747 
[ PubMed ID = 25340700 ] [ RRC reference ]