Mutants (Isolated)

tm2457

Allele Nametm2457
Allele TypeNormal
Sequence NameR74.3
Gene Namexbp-1
Worm BaseAllele Name tm2457
Gene Name xbp-1
Sequence R74.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10614/10615-11303/11304 (689 bp deletion)
ChromosomeIII
Putative gene structurejoin(10193..10372, 10423..10901, 10956..11091)
Map position-3.7
Balancer
Map position of balancer
Sequence of primersExtRev:CTTGATGTGAAGAGGCTGCG ,ExtFwd:GCTTTAGCATATACCCTCAC,IntFwd:CCTGGGCTTTAGCCCCATAT,IntRev:GTAGTCCAGGCAAATAACGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Dudkevich R, Koh JH, Beaudoin-Chabot C, Celik C, Lebenthal-Loinger I, Karako-Lampert S, Ahmad-Albukhari S, Thibault G, Henis-Korenblit S.
Neuronal IRE-1 coordinates an organism-wide cold stress response by regulating fat metabolism.
Cell Rep 2022 41(9) 111739 
[ PubMed ID = 36450261 ] [ RRC reference ]

Bhoi A, Palladino F, Fabrizio P.
Auxin confers protection against ER stress in Caenorhabditis elegans.
Biol Open 2021 10(2)  
[ PubMed ID = 33495210 ] [ RRC reference ]

Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M.
Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons.
PLoS Genet 2020 16(9) e1008704 
[ PubMed ID = 32986702 ] [ RRC reference ]

Yunger E, Safra M, Levi-Ferber M, Haviv-Chesner A, Henis-Korenblit S.
Innate immunity mediated longevity and longevity induced by germ cell removal converge on the C-type lectin domain protein IRG-7.
PLoS Genet 2017 13(2) e1006577 
[ PubMed ID = 28196094 ] [ RRC reference ]

Salzberg Y, Coleman AJ, Celestrin K, Cohen-Berkman M, Biederer T, Henis-Korenblit S, Bülow HE.
Reduced Insulin/Insulin-Like Growth Factor Receptor Signaling Mitigates Defective Dendrite Morphogenesis in Mutants of the ER Stress Sensor IRE-1.
PLoS Genet 2017 13(1) e1006579 
[ PubMed ID = 28114319 ] [ RRC reference ]

Kyriakakis E, Charmpilas N, Tavernarakis N.
Differential adiponectin signalling couples ER stress with lipid metabolism to modulate ageing in C. elegans.
Sci Rep 2017 7(1) 5115 
[ PubMed ID = 28698593 ] [ RRC reference ]

Richardson CE, Kooistra T, Kim DH.
An essential role for XBP-1 in host protection against immune activation in C. elegans.
Nature 2010 463(7284) 1092-5 
[ PubMed ID = 20182512 ] [ RRC reference ]

Henis-Korenblit S, Zhang P, Hansen M, McCormick M, Lee SJ, Cary M, Kenyon C.
Insulin/IGF-1 signaling mutants reprogram ER stress response regulators to promote longevity.
Proc Natl Acad Sci U S A 2010 107(21) 9730-5 
[ PubMed ID = 20460307 ] [ RRC reference ]

Safra M, Fickentscher R, Levi-Ferber M, Danino YM, Haviv-Chesner A, Hansen M, Juven-Gershon T, Weiss M, Henis-Korenblit S.
The FOXO transcription factor DAF-16 bypasses ire-1 requirement to promote endoplasmic reticulum homeostasis.
Cell Metab 2014 20(5) 870-881 
[ PubMed ID = 25448701 ] [ RRC reference ]

Kozlowski L, Garvis S, Bedet C, Palladino F.
The Caenorhabditis elegans HP1 family protein HPL-2 maintains ER homeostasis through the UPR and hormesis.
Proc Natl Acad Sci U S A 2014 111(16) 5956-61 
[ PubMed ID = 24715729 ] [ RRC reference ]

Safra M, Ben-Hamo S, Kenyon C, Henis-Korenblit S.
The ire-1 ER stress-response pathway is required for normal secretory-protein metabolism in C. elegans.
J Cell Sci 2013 126(Pt 18) 4136-46 
[ PubMed ID = 23843615 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S.
It's all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans.
PLoS Genet 2014 10(10) e1004747 
[ PubMed ID = 25340700 ] [ RRC reference ]