Mutants (Isolated)

tm2457

Allele Name

tm2457

Sequence Name

R74.3

CGC Name

xbp-1

Worm Base

Allele Name

tm2457

CGC Name

xbp-1

Sequence

R74.3

Phenotype

homozygous viable

Mutation site

10614/10615-11303/11304 (689 bp deletion)

Chromosome

III

Putative gene structure

join(10193..10372, 10423..10901, 10956..11091)

Map position

-3.7

Balancer

Map position of balancer

Sequence of primers

ExtRev:CTTGATGTGAAGAGGCTGCG ,ExtFwd:GCTTTAGCATATACCCTCAC,IntFwd:CCTGGGCTTTAGCCCCATAT,IntRev:GTAGTCCAGGCAAATAACGA

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Bhoi A, Palladino F, Fabrizio P.
Auxin confers protection against ER stress in Caenorhabditis elegans.
Biol Open 2021 10(2)
[ PubMed ID = 33495210 ] [ RRC reference ]

Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M.
Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons.
PLoS Genet 2020 16(9) e1008704
[ PubMed ID = 32986702 ] [ RRC reference ]

Yunger E, Safra M, Levi-Ferber M, Haviv-Chesner A, Henis-Korenblit S.
Innate immunity mediated longevity and longevity induced by germ cell removal converge on the C-type lectin domain protein IRG-7.
PLoS Genet 2017 13(2) e1006577
[ PubMed ID = 28196094 ] [ RRC reference ]

Salzberg Y, Coleman AJ, Celestrin K, Cohen-Berkman M, Biederer T, Henis-Korenblit S, Bülow HE.
Reduced Insulin/Insulin-Like Growth Factor Receptor Signaling Mitigates Defective Dendrite Morphogenesis in Mutants of the ER Stress Sensor IRE-1.
PLoS Genet 2017 13(1) e1006579
[ PubMed ID = 28114319 ] [ RRC reference ]

Kyriakakis E, Charmpilas N, Tavernarakis N.
Differential adiponectin signalling couples ER stress with lipid metabolism to modulate ageing in C. elegans.
Sci Rep 2017 7(1) 5115
[ PubMed ID = 28698593 ] [ RRC reference ]

Richardson CE, Kooistra T, Kim DH.
An essential role for XBP-1 in host protection against immune activation in C. elegans.
Nature 2010 463(7284) 1092-5
[ PubMed ID = 20182512 ] [ RRC reference ]

Henis-Korenblit S, Zhang P, Hansen M, McCormick M, Lee SJ, Cary M, Kenyon C.
Insulin/IGF-1 signaling mutants reprogram ER stress response regulators to promote longevity.
Proc Natl Acad Sci U S A 2010 107(21) 9730-5
[ PubMed ID = 20460307 ] [ RRC reference ]

Safra M, Fickentscher R, Levi-Ferber M, Danino YM, Haviv-Chesner A, Hansen M, Juven-Gershon T, Weiss M, Henis-Korenblit S.
The FOXO transcription factor DAF-16 bypasses ire-1 requirement to promote endoplasmic reticulum homeostasis.
Cell Metab 2014 20(5) 870-881
[ PubMed ID = 25448701 ] [ RRC reference ]

Kozlowski L, Garvis S, Bedet C, Palladino F.
The Caenorhabditis elegans HP1 family protein HPL-2 maintains ER homeostasis through the UPR and hormesis.
Proc Natl Acad Sci U S A 2014 111(16) 5956-61
[ PubMed ID = 24715729 ] [ RRC reference ]

Safra M, Ben-Hamo S, Kenyon C, Henis-Korenblit S.
The ire-1 ER stress-response pathway is required for normal secretory-protein metabolism in C. elegans.
J Cell Sci 2013 126(Pt 18) 4136-46
[ PubMed ID = 23843615 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S.
It's all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans.
PLoS Genet 2014 10(10) e1004747
[ PubMed ID = 25340700 ] [ RRC reference ]