Mutants (Isolated)

tm2447

Allele Nametm2447
Sequence NameM142.6
CGC Namerle-1
Worm BaseAllele Name tm2447
CGC Name rle-1
Sequence M142.6
Phenotypehomozygous viable. Dr. P. Hu: normal lifespan at 25C, does not enhance akt-1 dauer arrest.
Mutation site35792/35793-36054/36055 (262 bp deletion)
ChromosomeIII
Putative gene structurejoin(34039..34101, 34448..34750, 35530..36306, Z99276.1:105..698, Z99276.1:1364..1566, Z99276.1:1666..1772, Z99276.1:2495..2795, Z99276.1:3714..3928, Z99276.1:4056..4104, Z99276.1:5846..5958, Z99276.1:6478..6729, Z99276.1:7169..7338)
Map position5.65
Balancer
Map position of balancer
Sequence of primersIntFwd:TCGCGGACCCTCCAACGAAA,ExtFwd:CAGGAAATCTCGCGGACCCT,IntRev:CGCATCGAGGTATCCTCATG,ExtRev:GGTGCAATGCATCTCCGATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Alam H, Williams TW, Dumas KJ, Guo C, Yoshina S, Mitani S, Hu PJ.
EAK-7 controls development and life span by regulating nuclear DAF-16/FoxO activity.
Cell Metab. 2010 12(1) 30-41 
[ PubMed ID = 20620993 ] [ RRC reference ]