Allele Name | tm2443 |
Sequence Name | C33H5.15 |
CGC Name | sgo-1 |
Worm Base | Allele Name |
tm2443
|
CGC Name |
sgo-1
|
Sequence |
C33H5.15
|
Phenotype | homozygous viable. Dr. M. Colaiacovo: Genes & Dev, 22, 2869 (2008). Dr. H. Sawa: not Psa. |
Mutation site | 21762/21763-TTTTCTC-21966/21967 (204 bp deletion + 7 bp insertion) |
Chromosome | IV |
Putative gene structure | complement(join(21369..21491, 21585..21775, 21830..22009, 22061..22284, 22339..22406, 22462..22529, 22577..22646)) |
Map position | 3.48 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:GGTGTGTGGTCCGTGGTCAT,ExtFwd:AGGGCGGGAGTTGATGGCTT,IntRev:GAGCGCCAACGATTCTCTTG,IntFwd:CCTAGCCGTTGGCTTAGAAG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Kim T, Moyle MW, Lara-Gonzalez P, De Groot C, Oegema K, Desai A. Kinetochore-localized BUB-1/BUB-3 complex promotes anaphase onset in C. elegans. J Cell Biol 2015 209(4) 507-17
[ PubMed ID = 25987605 ]
[ RRC reference ]
|
Labocha MK, Jung SK, Aleman-Meza B, Liu Z, Zhong W. WormGender - Open-Source Software for Automatic Caenorhabditis elegans Sex Ratio Measurement. PLoS One 2015 10(9) e0139724
[ PubMed ID = 26421844 ]
[ RRC reference ]
|
Labocha MK, Yuan W, Aleman-Meza B, Zhong W. A strategy to apply quantitative epistasis analysis on developmental traits. BMC Genet 2017 18(1) 42
[ PubMed ID = 28506208 ]
[ RRC reference ]
|
de Carvalho CE, Zaaijer S, Smolikov S, Gu Y, Schumacher JM, Colaiácovo MP. LAB-1 antagonizes the Aurora B kinase in C. elegans. Genes Dev 2008 22(20) 2869-85
[ PubMed ID = 18923084 ]
[ RRC reference ]
|
|