Mutants (Isolated)

tm2443

Allele Nametm2443
Sequence NameC33H5.15
CGC Namesgo-1
Worm BaseAllele Name tm2443
CGC Name sgo-1
Sequence C33H5.15
Phenotypehomozygous viable. Dr. M. Colaiacovo: Genes & Dev, 22, 2869 (2008). Dr. H. Sawa: not Psa.
Mutation site21762/21763-TTTTCTC-21966/21967 (204 bp deletion + 7 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(21369..21491, 21585..21775, 21830..22009, 22061..22284, 22339..22406, 22462..22529, 22577..22646))
Map position3.48
Balancer
Map position of balancer
Sequence of primersExtRev:GGTGTGTGGTCCGTGGTCAT,ExtFwd:AGGGCGGGAGTTGATGGCTT,IntRev:GAGCGCCAACGATTCTCTTG,IntFwd:CCTAGCCGTTGGCTTAGAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kim T, Moyle MW, Lara-Gonzalez P, De Groot C, Oegema K, Desai A.
Kinetochore-localized BUB-1/BUB-3 complex promotes anaphase onset in C. elegans.
J. Cell Biol. 2015 209(4) 507-17 
[ PubMed ID = 25987605 ] [ RRC reference ]

Labocha MK, Jung SK, Aleman-Meza B, Liu Z, Zhong W.
WormGender - Open-Source Software for Automatic Caenorhabditis elegans Sex Ratio Measurement.
PLoS ONE 2015 10(9) e0139724 
[ PubMed ID = 26421844 ] [ RRC reference ]

Labocha MK, Yuan W, Aleman-Meza B, Zhong W.
A strategy to apply quantitative epistasis analysis on developmental traits.
BMC Genet. 2017 18(1) 42 
[ PubMed ID = 28506208 ] [ RRC reference ]

de Carvalho CE, Zaaijer S, Smolikov S, Gu Y, Schumacher JM, Colaiácovo MP.
LAB-1 antagonizes the Aurora B kinase in C. elegans.
Genes Dev. 2008 22(20) 2869-85 
[ PubMed ID = 18923084 ] [ RRC reference ]