Mutants (Isolated)

tm2435

Allele Nametm2435
Sequence NameR119.7
CGC Namernp-8
Worm BaseAllele Name tm2435
CGC Name rnp-8
Sequence R119.7
Phenotypehomozygous viable. Dr. J. Kimble: low percentage sterility.
Mutation site7405/7046-CTTTTTTTT-8031/8032 (626 bp deletion + 9 bp insertion)
ChromosomeI
Putative gene structurejoin(7315..7475, 7532..7987, 8327..8392, 8440..8756, 9449..10005, 10542..10736)
Map position-19.06
Balancer
Map position of balancer
Sequence of primersExtFwd:GATGAATGGTCAAGCGGATC,ExtRev:GCATAAACAACTGGCGACGA,IntFwd:GAACCGCCTACGTTTCGGGT,IntRev:GGCGACGATGTTCTCGGGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kim KW, Nykamp K, Suh N, Bachorik JL, Wang L, Kimble J.
Antagonism between GLD-2 binding partners controls gamete sex.
Dev. Cell 2009 16(5) 723-33 
[ PubMed ID = 19460348 ] [ RRC reference ]

Kim KW, Wilson TL, Kimble J.
GLD-2/RNP-8 cytoplasmic poly(A) polymerase is a broad-spectrum regulator of the oogenesis program.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(40) 17445-50 
[ PubMed ID = 20855596 ] [ RRC reference ]

Tsukamoto T, Gearhart MD, Spike CA, Huelgas-Morales G, Mews M, Boag PR, Beilharz TH, Greenstein D.
LIN-41 and OMA Ribonucleoprotein Complexes Mediate a Translational Repression-to-Activation Switch Controlling Oocyte Meiotic Maturation and the Oocyte-to-Embryo Transition in Caenorhabditis elegans.
Genetics 2017 206(4) 2007-2039 
[ PubMed ID = 28576864 ] [ RRC reference ]

Zanetti S, Grinschgl S, Meola M, Belfiore M, Rey S, Bianchi P, Puoti A.
The sperm-oocyte switch in the C. elegans hermaphrodite is controlled through steady-state levels of the fem-3 mRNA.
RNA 2012 18(7) 1385-94 
[ PubMed ID = 22635404 ] [ RRC reference ]

Zanetti S, Puoti A.
Sex determination in the Caenorhabditis elegans germline.
Adv. Exp. Med. Biol. 2013 757 41-69 
[ PubMed ID = 22872474 ] [ RRC reference ]