Mutants (Isolated)

tm2432

Allele Nametm2432
Sequence NameB0041.2
CGC Nameain-2
Worm BaseAllele Name tm2432
CGC Name ain-2
Sequence B0041.2
Phenotypehomozygous viable. Dr. M. Han: wild type (growth rate, brood size, vulva)
Mutation site14116/14117-14737/14738 (621 bp deletion)
ChromosomeI
Putative gene structurejoin(12233..12359, 12584..13321, 13374..13643, 14069..14350, 14802..15118, 15548..15625, 15872..16180)
Map position-1.03
Balancer
Map position of balancer
Sequence of primersIntFwd:CTCGTCACGTGGTTGGGATG,ExtFwd:CGATCAAAGCTCGTCACGTG,IntRev:CATAGTCGTCCAAACGCGGA,ExtRev:ATGTAGTGGCGAGACCCGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Jannot G, Michaud P, Quévillon Huberdeau M, Morel-Berryman L, Brackbill JA, Piquet S, McJunkin K, Nakanishi K, Simard MJ.
GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.
PLoS Genet. 2016 12(12) e1006484 
[ PubMed ID = 27935964 ] [ RRC reference ]

Zhang X, Zabinsky R, Teng Y, Cui M, Han M.
microRNAs play critical roles in the survival and recovery of Caenorhabditis elegans from starvation-induced L1 diapause.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(44) 17997-8002 
[ PubMed ID = 22011579 ] [ RRC reference ]

Kudlow BA, Zhang L, Han M.
Systematic analysis of tissue-restricted miRISCs reveals a broad role for microRNAs in suppressing basal activity of the C. elegans pathogen response.
Mol. Cell 2012 46(4) 530-41 
[ PubMed ID = 22503424 ] [ RRC reference ]

Than MT, Kudlow BA, Han M.
Functional analysis of neuronal microRNAs in Caenorhabditis elegans dauer formation by combinational genetics and Neuronal miRISC immunoprecipitation.
PLoS Genet. 2013 9(6) e1003592 
[ PubMed ID = 23818874 ] [ RRC reference ]

Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]