Mutants (Isolated)

tm2427

Allele Nametm2427
Sequence NameF33D4.3
CGC Nameflp-13
Worm BaseAllele Name tm2427
CGC Name flp-13
Sequence F33D4.3
Phenotypehomozygous viable. Dr. O. Hobert: wild-type chemotaxis to NaCl, NH4Ac and L-leucine. Dr. Y. Jin: normal movement, motor axons are normal, grow well.
Mutation site22647/22648-23027/23028 (380 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(22232..22424, 22750..22951, 23354..23441))
Map position3.39
Balancer
Map position of balancer
Sequence of primersExtRev:GTCGCCATTCAGGCCTTTGA,IntRev:GGATCCATTTCTCCTGACTT,ExtFwd:GTAGACACACAATCGTCGAC,IntFwd:CGTCGACTAAATGAGATCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nelson MD, Lee KH, Churgin MA, Hill AJ, Van Buskirk C, Fang-Yen C, Raizen DM.
FMRFamide-like FLP-13 neuropeptides promote quiescence following heat stress in Caenorhabditis elegans.
Curr. Biol. 2014 24(20) 2406-10 
[ PubMed ID = 25264253 ] [ RRC reference ]

Takahashi M, Takagi S.
Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans.
PLoS Genet. 2017 13(12) e1007134 
[ PubMed ID = 29281635 ] [ RRC reference ]

Trojanowski NF, Nelson MD, Flavell SW, Fang-Yen C, Raizen DM.
Distinct Mechanisms Underlie Quiescence during Two Caenorhabditis elegans Sleep-Like States.
J. Neurosci. 2015 35(43) 14571-84 
[ PubMed ID = 26511247 ] [ RRC reference ]

DeBardeleben HK, Lopes LE, Nessel MP, Raizen DM.
Stress-Induced Sleep After Exposure to Ultraviolet Light Is Promoted by p53 in Caenorhabditis elegans.
Genetics 2017 207(2) 571-582 
[ PubMed ID = 28754659 ] [ RRC reference ]

Lee JS, Shih PY, Schaedel ON, Quintero-Cadena P, Rogers AK, Sternberg PW.
FMRFamide-like peptides expand the behavioral repertoire of a densely connected nervous system.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(50) E10726-E10735 
[ PubMed ID = 29167374 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet. 2013 9(5) e1003472 
[ PubMed ID = 23658528 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]