Mutants (Isolated)

tm2423

Allele Nametm2423
Sequence NameY37A1B.2
CGC Namelst-4
Worm BaseAllele Name tm2423
CGC Name lst-4
Sequence Y37A1B.2
Phenotypehomozygous viable. Dr. O. Blacque: dye-filling normal. Dr.M. Hengartner: degradation of apoptotic cells in the germline is impaired.
Mutation site89961/89962-90173/90174 (212 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(88215..88448, 89008..89174, 89234..89311, 89367..89470, 89536..89870, 89917..90273, 93654..93875, 95893..95994, 96601..96696))
Map position11.3
Balancer
Map position of balancer
Sequence of primersExtFwd:GCACTGGTTCCATGTCATTC,IntRev:GTAGCCACTCGGAACACGGT,ExtRev:TGACCTCAGCCGTAGCCACT,IntFwd:CTTCGTGTGCGCATCGAATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cheng S, Wang K, Zou W, Miao R, Huang Y, Wang H, Wang X.
PtdIns(4,5)P₂ and PtdIns3P coordinate to regulate phagosomal sealing for apoptotic cell clearance.
J. Cell Biol. 2015 210(3) 485-502 
[ PubMed ID = 26240185 ] [ RRC reference ]

Almendinger J, Doukoumetzidis K, Kinchen JM, Kaech A, Ravichandran KS, Hengartner MO.
A conserved role for SNX9-family members in the regulation of phagosome maturation during engulfment of apoptotic cells.
PLoS ONE 2011 6(4) e18325 
[ PubMed ID = 21494661 ] [ RRC reference ]

Xu M, Liu Y, Zhao L, Gan Q, Wang X, Yang C.
The lysosomal cathepsin protease CPL-1 plays a leading role in phagosomal degradation of apoptotic cells in Caenorhabditis elegans.
Mol. Biol. Cell 2014 25(13) 2071-83 
[ PubMed ID = 24829385 ] [ RRC reference ]

Chen D, Jian Y, Liu X, Zhang Y, Liang J, Qi X, Du H, Zou W, Chen L, Chai Y, Ou G, Miao L, Wang Y, Yang C.
Clathrin and AP2 are required for phagocytic receptor-mediated apoptotic cell clearance in Caenorhabditis elegans.
PLoS Genet. 2013 9(5) e1003517 
[ PubMed ID = 23696751 ] [ RRC reference ]

Ghose P, Rashid A, Insley P, Trivedi M, Shah P, Singhal A, Lu Y, Bao Z, Shaham S.
EFF-1 fusogen promotes phagosome sealing during cell process clearance in Caenorhabditis elegans.
Nat. Cell Biol. 2018 20(4) 393-399 
[ PubMed ID = 29556089 ] [ RRC reference ]

Norris AD, Gao S, Norris ML, Ray D, Ramani AK, Fraser AG, Morris Q, Hughes TR, Zhen M, Calarco JA.
A pair of RNA-binding proteins controls networks of splicing events contributing to specialization of neural cell types.
Mol. Cell 2014 54(6) 946-59 
[ PubMed ID = 24910101 ] [ RRC reference ]

Chen D, Xiao H, Zhang K, Wang B, Gao Z, Jian Y, Qi X, Sun J, Miao L, Yang C.
Retromer is required for apoptotic cell clearance by phagocytic receptor recycling.
Science 2010 327(5970) 1261-4 
[ PubMed ID = 20133524 ] [ RRC reference ]

Vieira N, Bessa C, Rodrigues AJ, Marques P, Chan FY, de Carvalho AX, Correia-Neves M, Sousa N.
Sorting nexin 3 mutation impairs development and neuronal function in Caenorhabditis elegans.
Cell. Mol. Life Sci. 2018 75(11) 2027-2044 
[ PubMed ID = 29196797 ] [ RRC reference ]

Oikonomou G, Perens EA, Lu Y, Shaham S.
Some, but not all, retromer components promote morphogenesis of C. elegans sensory compartments.
Dev. Biol. 2012 362(1) 42-9 
[ PubMed ID = 22138055 ] [ RRC reference ]

Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z.
Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling.
Mol. Biol. Cell 2011 22(3) 354-74 
[ PubMed ID = 21148288 ] [ RRC reference ]