Mutants (Isolated)

tm2422

Allele Nametm2422
Sequence NameF54C1.2
CGC Namedom-3
Worm BaseAllele Name tm2422
CGC Name dom-3
Sequence F54C1.2
Phenotypehomozygous viable. Dr. M. Han: wild-type (growth rate, brood size, vulva).
Mutation site15049/15050-15527/15528 (478 bp deletion)
ChromosomeI
Putative gene structurejoin(14743..14857, 14907..15012, 15056..15391, 15440..15524, 15623..16162)
Map position-0.43
Balancer
Map position of balancer
Sequence of primersExtFwd:CAGTAACCTACATTGTGGTC,IntFwd:CTACATTGTGGTCTACCGCT,ExtRev:TCGAGGAACTCATTCGGCAC,IntRev:CGAATTCATCTACCGGTACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shen Y, Zhang J, Calarco JA, Zhang Y.
EOL-1, the homolog of the mammalian Dom3Z, regulates olfactory learning in C. elegans.
J. Neurosci. 2014 34(40) 13364-70 
[ PubMed ID = 25274815 ] [ RRC reference ]