Mutants (Isolated)

tm2416

Allele Nametm2416
Sequence NameZK84.6
CGC Nameins-6
Worm BaseAllele Name tm2416
CGC Name ins-6
Sequence ZK84.6
Phenotypehomozygous viable. Dr. K. Ashrafi: slightly increased Nile Red staining. Dr. M. Driscoll: normal dauer formation. Dr. P.W. Sternberg: slow locomotion. Dr. J. Kaplan: normal nile red staining. Dr. Q.L. Ch'ng: non-Unc, non-Pvl, non-Lon, non-Sma, non-Dpy.
Mutation site4004/4005-4320/4321 (316 bp deletion)
ChromosomeII
Putative gene structurejoin(4009..4267, 4322..4401)
Map position-0.7
Balancer
Map position of balancer
Sequence of primersExtRev:TTGTACAAGCCACTGGGATG,IntRev:ACAGAGACTGATATCGGAGT,ExtFwd:TTTACCCACCCCTTCGTGAT,IntFwd:TCGTGATGCTCCGCCTATTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kaplan REW, Maxwell CS, Codd NK, Baugh LR.
Pervasive Positive and Negative Feedback Regulation of Insulin-Like Signaling in Caenorhabditis elegans.
Genetics 2019 211(1) 349-361 
[ PubMed ID = 30425043 ] [ RRC reference ]

Lee K, Mylonakis E.
An Intestine-Derived Neuropeptide Controls Avoidance Behavior in Caenorhabditis elegans.
Cell Rep 2017 20(10) 2501-2512 
[ PubMed ID = 28877481 ] [ RRC reference ]

Kaul TK, Reis Rodrigues P, Ogungbe IV, Kapahi P, Gill MS.
Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.
PLoS One 2014 9(1) e86979 
[ PubMed ID = 24475206 ] [ RRC reference ]

Harris G, Wu T, Linfield G, Choi MK, Liu H, Zhang Y.
Molecular and cellular modulators for multisensory integration in C. elegans.
PLoS Genet 2019 15(3) e1007706 
[ PubMed ID = 30849079 ] [ RRC reference ]

Reis Rodrigues P, Kaul TK, Ho JH, Lucanic M, Burkewitz K, Mair WB, Held JM, Bohn LM, Gill MS.
Synthetic Ligands of Cannabinoid Receptors Affect Dauer Formation in the Nematode Caenorhabditis elegans.
G3 (Bethesda) 2016 6(6) 1695-705 
[ PubMed ID = 27172180 ] [ RRC reference ]

Baugh LR, Kurhanewicz N, Sternberg PW.
Sensitive and precise quantification of insulin-like mRNA expression in Caenorhabditis elegans.
PLoS One 2011 6(3) e18086 
[ PubMed ID = 21445366 ] [ RRC reference ]

Guillermin ML, Carrillo MA, Hallem EA.
A Single Set of Interneurons Drives Opposite Behaviors in C. elegans.
Curr Biol 2017 27(17) 2630-2639.e6 
[ PubMed ID = 28823678 ] [ RRC reference ]

Chen Z, Hendricks M, Cornils A, Maier W, Alcedo J, Zhang Y.
Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans.
Neuron 2013 77(3) 572-85 
[ PubMed ID = 23395381 ] [ RRC reference ]

Matsunaga Y, Honda Y, Honda S, Iwasaki T, Qadota H, Benian GM, Kawano T.
Diapause is associated with a change in the polarity of secretion of insulin-like peptides.
Nat Commun 2016 7 10573 
[ PubMed ID = 26838180 ] [ RRC reference ]

Ohta A, Ujisawa T, Sonoda S, Kuhara A.
Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans.
Nat Commun 2014 5 4412 
[ PubMed ID = 25048458 ] [ RRC reference ]

Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR.
Insulin-like signalling to the maternal germline controls progeny response to osmotic stress.
Nat Cell Biol 2017 19(3) 252-257 
[ PubMed ID = 28166192 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330 
[ PubMed ID = 28131836 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev Biol 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc Natl Acad Sci U S A 2013 110(29) 11940-5 
[ PubMed ID = 23818641 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79 
[ PubMed ID = 24671950 ] [ RRC reference ]

Cornils A, Gloeck M, Chen Z, Zhang Y, Alcedo J.
Specific insulin-like peptides encode sensory information to regulate distinct developmental processes.
Development 2011 138(6) 1183-93 
[ PubMed ID = 21343369 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60 
[ PubMed ID = 23665919 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]