| Allele Name | tm2409 |
| Sequence Name | Y111B2A.26 |
| CGC Name | snx-13 |
| Worm Base | Allele Name |
tm2409
|
| CGC Name |
snx-13
|
| Sequence |
Y111B2A.26
|
| Phenotype | homozygous viable. Dr. G. Jansen: normal dye filling. |
| Mutation site | 31142/31143-31317/31318 (175 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(27216..27458, 29462..29713, 30863..30986, 31229..31413, 33354..33478, 34228..34335, 34852..34930) |
| Map position | 16.13 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CGCGCAAATTCGTGAAGACC,IntFwd:CGTGAAGACCTTGACCGCCA,ExtRev:TTCGGAGTGCCTTGGGGAGT,IntRev:CTTGGGGAGTTTCGGCAAAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Broekhuis JR, Rademakers S, Burghoorn J, Jansen G.
SQL-1, homologue of the Golgi protein GMAP210, modulates intraflagellar transport in C. elegans.
J Cell Sci 2013 126(Pt 8) 1785-95
[ PubMed ID = 23444385 ]
[ RRC reference ]
|
van der Vaart A, Rademakers S, Jansen G.
DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.
PLoS Genet 2015 11(12) e1005733
[ PubMed ID = 26657059 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.