Mutants (Isolated)

tm2409

Allele Nametm2409
Allele TypeNormal
Sequence NameY111B2A.26
Gene Namesnx-13
Worm BaseAllele Name tm2409
Gene Name snx-13
Sequence Y111B2A.26
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Jansen: normal dye filling.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31142/31143-31317/31318 (175 bp deletion)
ChromosomeIV
Putative gene structurejoin(27216..27458, 29462..29713, 30863..30986, 31229..31413, 33354..33478, 34228..34335, 34852..34930)
Map position16.13
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCGCAAATTCGTGAAGACC,IntFwd:CGTGAAGACCTTGACCGCCA,ExtRev:TTCGGAGTGCCTTGGGGAGT,IntRev:CTTGGGGAGTTTCGGCAAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
van der Vaart A, Rademakers S, Jansen G.
DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.
PLoS Genet 2015 11(12) e1005733 
[ PubMed ID = 26657059 ] [ RRC reference ]

Broekhuis JR, Rademakers S, Burghoorn J, Jansen G.
SQL-1, homologue of the Golgi protein GMAP210, modulates intraflagellar transport in C. elegans.
J Cell Sci 2013 126(Pt 8) 1785-95 
[ PubMed ID = 23444385 ] [ RRC reference ]