Home > Mutants (Isolated) > tm2409

Mutants (Isolated)

Allele Name		tm2409
Allele Type		Normal
Sequence Name		Y111B2A.26
Gene Name		snx-13
Worm Base	Allele Name	tm2409
	Gene Name	snx-13
	Sequence	Y111B2A.26
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. G. Jansen: normal dye filling.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		31142/31143-31317/31318 (175 bp deletion)
Chromosome		IV
Putative gene structure		join(27216..27458, 29462..29713, 30863..30986, 31229..31413, 33354..33478, 34228..34335, 34852..34930)
Map position		16.13
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CGCGCAAATTCGTGAAGACC,IntFwd:CGTGAAGACCTTGACCGCCA,ExtRev:TTCGGAGTGCCTTGGGGAGT,IntRev:CTTGGGGAGTTTCGGCAAAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication van der Vaart A, Rademakers S, Jansen G. DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans. PLoS Genet 2015 11(12) e1005733  [ PubMed ID = 26657059 ] [ RRC reference ] Broekhuis JR, Rademakers S, Burghoorn J, Jansen G. SQL-1, homologue of the Golgi protein GMAP210, modulates intraflagellar transport in C. elegans. J Cell Sci 2013 126(Pt 8) 1785-95  [ PubMed ID = 23444385 ] [ RRC reference ]